TALEN

TALEN1-nkx3-2

ID

ZDB-TALEN-210317-1

Name

TALEN1-nkx3-2

Previous Names

None

Target

nkx3-2 (1)

Target Sequence 1

5' - TAATGCTCCGCGACCCGGTC - 3'

Target Sequence 2

5' - TTACTGCGCACAGCCATGTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
el802	nkx3-2

Expression

Gene expression in Wild Types + TALEN1-nkx3-2

No data available

Phenotype

Phenotype resulting from TALEN1-nkx3-2

No data available

Phenotype of all Fish created by or utilizing TALEN1-nkx3-2

Phenotype	Fish	Conditions	Figures
basihyal bone anteroventral orientation, abnormal	nkx3-2^el802/el802	standard conditions	text only from Miyashita et al., 2020
anguloarticular increased size, abnormal	nkx3-2^el802/el802	standard conditions	text only from Miyashita et al., 2020
exoccipital increased size, abnormal	nkx3-2^el802/el802	standard conditions	text only from Miyashita et al., 2020
Meckel's cartilage-palatoquadrate cartilage joint ptgdsb.1 expression increased amount, abnormal	nkx3-2^el802/el802	standard conditions	Fig. 6 from Smeeton et al., 2021
cranium increased width, abnormal	nkx3-2^el802/el802	standard conditions	text only from Miyashita et al., 2020
quadrate-anguloarticular joint absent, abnormal	nkx3-2^el802/el802	standard conditions	text only from Miyashita et al., 2020
mouth open, abnormal	nkx3-2^el802/el802	standard conditions	Fig. 1 , Fig. 4 from Smeeton et al., 2021 text only from Miyashita et al., 2020
ossification increased occurrence, abnormal	nkx3-2^el802/el802	standard conditions	text only from Miyashita et al., 2020
supraorbital bone increased size, abnormal	nkx3-2^el802/el802	standard conditions	text only from Miyashita et al., 2020
Meckel's cartilage-palatoquadrate cartilage joint chondrocyte proliferative, abnormal	nkx3-2^el802/el802	standard conditions	Fig. 3 , Fig. 4 from Smeeton et al., 2021
infraorbital increased size, abnormal	nkx3-2^el802/el802	standard conditions	text only from Miyashita et al., 2020
articular cartilage hypertrophic, abnormal	nkx3-2^el802/el802	standard conditions	Fig. 3 , Fig. 4 from Smeeton et al., 2021
cranium decreased length, abnormal	nkx3-2^el802/el802	standard conditions	text only from Miyashita et al., 2020
ventral mandibular arch cartilage element fused with palatoquadrate cartilage, abnormal	nkx3-2^el802/el802	standard conditions	Fig. 4 from Smeeton et al., 2021
Meckel's cartilage-palatoquadrate cartilage joint absent, abnormal	nkx3-2^el802/el802	standard conditions	Fig. 1 , Fig. 4 from Smeeton et al., 2021
basihyal bone increased size, abnormal	nkx3-2^el802/el802	standard conditions	text only from Miyashita et al., 2020
kinethmoid bone absent, abnormal	nkx3-2^el802/el802	standard conditions	text only from Miyashita et al., 2020
supraorbital bone flared, abnormal	nkx3-2^el802/el802	standard conditions	text only from Miyashita et al., 2020
quadrate fused with anguloarticular, abnormal	nkx3-2^el802/el802	standard conditions	text only from Miyashita et al., 2020
Meckel's cartilage-palatoquadrate cartilage joint sesn1 expression increased amount, abnormal	nkx3-2^el802/el802	standard conditions	Fig. 6 from Smeeton et al., 2021
naris mislocalised posteriorly, abnormal	nkx3-2^el802/el802	standard conditions	text only from Miyashita et al., 2020
orbitosphenoid immobile, abnormal	nkx3-2^el802/el802	standard conditions	Fig. 1 from Smeeton et al., 2021
pterosphenoid immobile, abnormal	nkx3-2^el802/el802	standard conditions	Fig. 1 from Smeeton et al., 2021
ceratobranchial bone lateral orientation, abnormal	nkx3-2^el802/el802	standard conditions	text only from Miyashita et al., 2020
infraorbital flared, abnormal	nkx3-2^el802/el802	standard conditions	text only from Miyashita et al., 2020
Meckel's cartilage-palatoquadrate cartilage joint col10a1a expression absent, abnormal	nkx3-2^el802/el802	standard conditions	Fig. 6 from Smeeton et al., 2021
quadrate increased size, abnormal	nkx3-2^el802/el802	standard conditions	text only from Miyashita et al., 2020
endochondral bone immobile, abnormal	nkx3-2^el802/el802	standard conditions	Fig. 1 from Smeeton et al., 2021
articular cartilage chondrocyte EGFP expression absent, abnormal	nkx3-2^el802/el802; trps1^j1271aGt/+; el10Tg/+	standard conditions	Fig. 1 from Smeeton et al., 2021

Citations