TALEN

TALEN1-gcgrb

ID
ZDB-TALEN-160205-2
Name
TALEN1-gcgrb
Previous Names
None
Target
Target Sequence 1
5' - CTTCTGGGAAATCTCTGAAG - 3'
Target Sequence 2
5' - CATTGGTGTAGATCCTCCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
vu601 gcgrb
Expression
Gene expression in Wild Types + TALEN1-gcgrb
No data available
Phenotype
Phenotype resulting from TALEN1-gcgrb
No data available
Phenotype of all Fish created by or utilizing TALEN1-gcgrb
Phenotype Fish Conditions Figures
glucose homeostasis process quality, abnormal gcgrbvu601/vu601 standard conditions Fig. 6 from Li et al., 2015
whole organism pck2 expression decreased amount, abnormal gcgrbvu601/vu601 standard conditions Fig. 6 from Li et al., 2015
whole organism gcgrb expression decreased amount, abnormal gcgrbvu601/vu601 standard conditions Fig. 3 from Li et al., 2015
whole organism pck1 expression decreased amount, abnormal gcgrbvu601/vu601 standard conditions Fig. 6 from Li et al., 2015
primary islet pancreatic A cell GFP expression increased amount, abnormal gcgrbvu601/vu601; ia1Tg standard conditions Fig. 4Fig. 5 from Li et al., 2015
pancreatic A cell cell population proliferation increased rate, abnormal gcgrbvu601/vu601; ia1Tg standard conditions Fig. 5 from Li et al., 2015
pancreatic A cell hyperplastic, abnormal gcgrbvu601/vu601; ia1Tg standard conditions Fig. 4 from Li et al., 2015
pancreatic acinar cell hypertrophic, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 3 with imageFigure 6 with image from Dai et al., 2024
whole organism pcsk9 expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
whole organism gcgra expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Fig. 3 from Li et al., 2015
whole organism fcsk expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
acinar cell proliferation increased occurrence, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 3 with imageFigure 6 with image from Dai et al., 2024
glucose homeostasis process quality, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Fig. 6 from Li et al., 2015
whole organism papss1 expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
whole organism elovl7b expression increased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
whole organism methionine decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 6 with image from Kang et al., 2020
whole organism ndufs8b expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
whole organism isoleucine decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 6 with image from Kang et al., 2020
whole organism gale expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
whole organism adh5l expression increased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
whole organism eevs expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
whole organism gcga expression increased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Fig. 6 from Li et al., 2015
pancreatic acinar cell proliferative, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 3 with imageFigure 6 with image from Dai et al., 2024
whole organism hadhaa expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
whole organism pck2 expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Fig. 6 from Li et al., 2015
whole organism tyrosine decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 6 with image from Kang et al., 2020
whole organism g6pc1a.1 expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Fig. 6 from Li et al., 2015
whole organism dnmt1 expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
whole organism cox11 expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
whole organism pvalb3 expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
whole organism apobb.2 expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
whole organism fasn2 expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
D-glucose import increased process quality, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 5 with image from Kang et al., 2020
whole organism gcgrb expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Fig. 3 from Li et al., 2015
whole organism pck1 expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Fig. 6 from Li et al., 2015
whole organism lipca expression increased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
glucagon secretion increased process quality, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Fig. 6 from Li et al., 2015
whole organism mlycd expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
liver lipid increased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 4 with image from Kang et al., 2020
whole organism acss2l expression increased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
whole organism slc2a1a expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
whole organism cthl expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
whole organism il4i1 expression decreased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
whole organism gcgb expression increased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601 standard conditions Figure 7 with image from Kang et al., 2020
Fig. 6 from Li et al., 2015
pancreatic acinar cell nucleus yap1 expression mislocalised, abnormal gcgravu600/vu600; gcgrbvu601/vu601; gz2Tg standard conditions Figure 5 with image from Dai et al., 2024
pancreatic acinar cell yap1 expression position, ameliorated gcgravu600/vu600; gcgrbvu601/vu601; gz2Tg chemical treatment by environment: sirolimus Figure 5 with image from Dai et al., 2024
pancreatic acinar cell ab9-rps6 labeling increased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601; gz2Tg standard conditions Figure 6 with image from Dai et al., 2024
primary islet pancreatic A cell GFP expression increased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601; ia1Tg standard conditions Fig. 4Fig. 5 from Li et al., 2015
pancreas has extra parts of type pancreatic A cell, ameliorated gcgravu600/vu600; gcgrbvu601/vu601; ia1Tg chemical treatment by environment: sirolimus Fig. 3 with image from Dean et al., 2017
pancreatic A cell amount, ameliorated gcgravu600/vu600; gcgrbvu601/vu601; ia1Tg chemical treatment: glucose Figure 5 with image from Kang et al., 2020
pancreatic A cell increased amount, abnormal gcgravu600/vu600; gcgrbvu601/vu601; ia1Tg standard conditions Figure 5 with image from Kang et al., 2020
pancreas has extra parts of type pancreatic A cell, abnormal gcgravu600/vu600; gcgrbvu601/vu601; ia1Tg standard conditions Fig. 3 with imageFig. 4 with image from Dean et al., 2017
pancreatic A cell cell population proliferation increased rate, abnormal gcgravu600/vu600; gcgrbvu601/vu601; ia1Tg standard conditions Fig. 5 from Li et al., 2015
pancreatic A cell hyperplastic, abnormal gcgravu600/vu600; gcgrbvu601/vu601; ia1Tg standard conditions Fig. 4 from Li et al., 2015
pancreatic acinar cell hypertrophic, ameliorated gcgravu600/vu600; gcgrbvu601/vu601 + CRISPR3-slc38a5b + CRISPR4-slc38a5b standard conditions Figure 3 with image from Dai et al., 2024
acinar cell proliferation occurrence, ameliorated gcgravu600/vu600; gcgrbvu601/vu601 + CRISPR3-slc38a5b + CRISPR4-slc38a5b standard conditions Figure 3 with image from Dai et al., 2024
pancreatic acinar cell proliferative, ameliorated gcgravu600/vu600; gcgrbvu601/vu601 + CRISPR3-slc38a5b + CRISPR4-slc38a5b standard conditions Figure 3 with image from Dai et al., 2024
pancreatic acinar cell hypertrophic, ameliorated gcgravu600/vu600; gcgrbvu601/vu601 + CRISPR13-yap1 + CRISPR14-yap1 standard conditions Figure 6 with image from Dai et al., 2024
acinar cell proliferation occurrence, ameliorated gcgravu600/vu600; gcgrbvu601/vu601 + CRISPR13-yap1 + CRISPR14-yap1 standard conditions Figure 6 with image from Dai et al., 2024
pancreatic acinar cell proliferative, ameliorated gcgravu600/vu600; gcgrbvu601/vu601 + CRISPR13-yap1 + CRISPR14-yap1 standard conditions Figure 6 with image from Dai et al., 2024
pancreatic acinar cell yap1 expression position, ameliorated gcgravu600/vu600; gcgrbvu601/vu601; gz2Tg + CRISPR3-slc38a5b + CRISPR4-slc38a5b standard conditions Figure 5 with image from Dai et al., 2024
pancreatic acinar cell ab9-rps6 labeling amount, ameliorated gcgravu600/vu600; gcgrbvu601/vu601; gz2Tg + CRISPR13-yap1 + CRISPR14-yap1 standard conditions Figure 6 with image from Dai et al., 2024
pancreas has extra parts of type pancreatic A cell, abnormal gcgravu600/vu600; gcgrbvu601/vu601; ia1Tg + CRISPR1-slc38a5a standard conditions Fig. 4 with image from Dean et al., 2017
pancreas has extra parts of type pancreatic A cell, ameliorated gcgravu600/vu600; gcgrbvu601/vu601; ia1Tg + CRISPR1-slc38a5b standard conditions Fig. 4 with image from Dean et al., 2017
pancreas has extra parts of type pancreatic A cell, ameliorated gcgravu600/vu600; gcgrbvu601/vu601; ia1Tg + CRISPR1-slc38a5a + CRISPR1-slc38a5b standard conditions Fig. 4 with image from Dean et al., 2017
Citations