Morpholino

MO3-tgfbr2b

ID

ZDB-MRPHLNO-260813-2

Name

MO3-tgfbr2b

Previous Names

None

Target

tgfbr2b (1)

Sequence

5' - AAGTGTTTGATGTTGTACCTGGTGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-tgfbr2b

No data available

Phenotype

Phenotype resulting from MO3-tgfbr2b

Phenotype	Fish	Figures
caudal fin decreased length, abnormal	AB + MO3-tgfbr2b	Fig. 2 from Chida et al., 2026
eye decreased size, abnormal	AB + MO3-tgfbr2b	Fig. 2 from Chida et al., 2026
head blunt, abnormal	AB + MO3-tgfbr2b	Fig. 2 from Chida et al., 2026
heart linear, abnormal	AB + MO3-tgfbr2b	Fig. 2 from Chida et al., 2026
pericardium edematous, abnormal	AB + MO3-tgfbr2b	Fig. 2 from Chida et al., 2026
whole organism decreased size, abnormal	AB + MO3-tgfbr2b	Fig. 2 from Chida et al., 2026
whole organism bmp4 expression increased amount, abnormal	AB + MO3-tgfbr2b	Fig. 4 from Chida et al., 2026
whole organism mmp2 expression increased amount, abnormal	AB + MO3-tgfbr2b	Fig. 4 from Chida et al., 2026
whole organism bmp2a expression increased amount, abnormal	AB + MO3-tgfbr2b	Fig. 4 from Chida et al., 2026
whole organism smad4a expression increased amount, abnormal	AB + MO3-tgfbr2b	Fig. 3 from Chida et al., 2026
whole organism smad5 expression increased amount, abnormal	AB + MO3-tgfbr2b	Fig. 4 from Chida et al., 2026
whole organism smad1 expression increased amount, abnormal	AB + MO3-tgfbr2b	Fig. 4 from Chida et al., 2026
whole organism smad9 expression increased amount, abnormal	AB + MO3-tgfbr2b	Fig. 4 from Chida et al., 2026
whole organism ccn2a expression increased amount, abnormal	AB + MO3-tgfbr2b	Fig. 4 from Chida et al., 2026
whole organism tgfb1a expression increased amount, abnormal	AB + MO3-tgfbr2b	Fig. 3 from Chida et al., 2026

Phenotype of all Fish created by or utilizing MO3-tgfbr2b

Phenotype	Fish	Conditions	Figures
caudal fin decreased length, abnormal	AB + MO3-tgfbr2b	control	Fig. 2 from Chida et al., 2026
heart linear, abnormal	AB + MO3-tgfbr2b	control	Fig. 2 from Chida et al., 2026
whole organism bmp2a expression increased amount, abnormal	AB + MO3-tgfbr2b	control	Fig. 4 from Chida et al., 2026
head blunt, abnormal	AB + MO3-tgfbr2b	control	Fig. 2 from Chida et al., 2026
whole organism mmp2 expression increased amount, abnormal	AB + MO3-tgfbr2b	control	Fig. 4 from Chida et al., 2026
whole organism smad1 expression increased amount, abnormal	AB + MO3-tgfbr2b	control	Fig. 4 from Chida et al., 2026
whole organism smad5 expression increased amount, abnormal	AB + MO3-tgfbr2b	control	Fig. 4 from Chida et al., 2026
whole organism tgfb1a expression increased amount, abnormal	AB + MO3-tgfbr2b	control	Fig. 3 from Chida et al., 2026
pericardium edematous, abnormal	AB + MO3-tgfbr2b	control	Fig. 2 from Chida et al., 2026
whole organism smad4a expression increased amount, abnormal	AB + MO3-tgfbr2b	control	Fig. 3 from Chida et al., 2026
eye decreased size, abnormal	AB + MO3-tgfbr2b	control	Fig. 2 from Chida et al., 2026
whole organism bmp4 expression increased amount, abnormal	AB + MO3-tgfbr2b	control	Fig. 4 from Chida et al., 2026
whole organism ccn2a expression increased amount, abnormal	AB + MO3-tgfbr2b	control	Fig. 4 from Chida et al., 2026
whole organism decreased size, abnormal	AB + MO3-tgfbr2b	control	Fig. 2 from Chida et al., 2026
whole organism smad9 expression increased amount, abnormal	AB + MO3-tgfbr2b	control	Fig. 4 from Chida et al., 2026
atrium linear, abnormal	mitfa^w2/w2; mpv17^a9/a9; la116Tg + MO3-tgfbr2b (AB)	control	Fig. 2 from Chida et al., 2026
eye decreased size, abnormal	mitfa^w2/w2; mpv17^a9/a9; la116Tg + MO3-tgfbr2b (AB)	control	Fig. 2 from Chida et al., 2026
pericardium edematous, abnormal	mitfa^w2/w2; mpv17^a9/a9; la116Tg + MO3-tgfbr2b (AB)	control	Fig. 2 from Chida et al., 2026
cardiac ventricle linear, abnormal	mitfa^w2/w2; mpv17^a9/a9; la116Tg + MO3-tgfbr2b (AB)	control	Fig. 2 from Chida et al., 2026

Citations