Morpholino
MO2-stx4
- ID
- ZDB-MRPHLNO-240425-2
- Name
- MO2-stx4
- Previous Names
- None
- Target
- Sequence
-
5' - AGCTAAATTACTTACTGTCCTCTGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-stx4
No data available
Phenotype
Phenotype resulting from MO2-stx4
1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO2-stx4
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
whole organism decreased size, abnormal | AB/TU + MO2-stx4 | control |
Fig. 3
from Schrauwen et al., 2022 |
head increased ratio trunk, abnormal | AB/TU + MO2-stx4 | control |
Fig. 3
from Schrauwen et al., 2022 |
post-vent region curved, abnormal | AB/TU + MO2-stx4 | control |
Fig. 3
from Schrauwen et al., 2022 |
post-vent region absence of anatomical entity, abnormal | AB/TU + MO2-stx4 | control |
Fig. 3
from Schrauwen et al., 2022 |
pericardium edematous, abnormal | AB/TU + MO2-stx4 | control |
Fig. 3
from Schrauwen et al., 2022 |
1 - 5 of 9 Show all
Citations