Morpholino
MO1-traf7
- ID
- ZDB-MRPHLNO-240117-2
- Name
- MO1-traf7
- Previous Names
- None
- Target
- Sequence
-
5' - CAGAAGATTGCTGACACTCACCGTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
splice-blocking morpholino
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-traf7
No data available
Phenotype
Phenotype resulting from MO1-traf7
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO1-traf7
1 - 5 of 7 Show all
Citations
- Song, X., Hu, R., Chen, Y., Xiao, M., Zhang, H., Wu, S., Lu, Q. (2024) The structure of TRAF7 coiled-coil trimer provides insight into its function in zebrafish embryonic development. Journal of molecular cell biology. 16(1):
- Mishra-Gorur, K., Barak, T., Kaulen, L.D., Henegariu, O., Jin, S.C., Aguilera, S.M., Yalbir, E., Goles, G., Nishimura, S., Miyagishima, D., Djenoune, L., Altinok, S., Rai, D.K., Viviano, S., Prendergast, A., Zerillo, C., Ozcan, K., Baran, B., Sencar, L., Goc, N., Yarman, Y., Ercan-Sencicek, A.G., Bilguvar, K., Lifton, R.P., Moliterno, J., Louvi, A., Yuan, S., Deniz, E., Brueckner, M., Gunel, M. (2023) Pleiotropic role of TRAF7 in skull-base meningiomas and congenital heart disease. Proceedings of the National Academy of Sciences of the United States of America. 120:e2214997120e2214997120
1 - 2 of 2
Show