Morpholino

MO1-dusp14

ID

ZDB-MRPHLNO-220830-1

Name

MO1-dusp14

Previous Names

None

Target

dusp14 (1)

Sequence

5' - GTGCACCTAAAACAGACCAAGAGAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dusp14

Expressed Gene	Anatomy	Figures
eya1	posterior lateral line neuromast	FIGURE 3 from Wei et al., 2022
sox2	neuromast support cell	FIGURE 4 from Wei et al., 2022

Phenotype

Phenotype resulting from MO1-dusp14

Phenotype	Fish	Figures
auditory receptor cell decreased amount, abnormal	AB + MO1-dusp14	FIGURE 3 , FIGURE 6 from Wei et al., 2022
neuromast hair cell decreased amount, abnormal	AB + MO1-dusp14	FIGURE 3 , FIGURE 6 from Wei et al., 2022
neuromast support cell decreased amount, abnormal	AB + MO1-dusp14	FIGURE 4 , FIGURE 6 from Wei et al., 2022
neuromast support cell sox2 expression decreased amount, abnormal	AB + MO1-dusp14	FIGURE 4 from Wei et al., 2022
neuromast support cell cell population proliferation decreased occurrence, abnormal	AB + MO1-dusp14	FIGURE 4 , FIGURE 6 from Wei et al., 2022
posterior lateral line neuromast eya1 expression decreased amount, abnormal	AB + MO1-dusp14	FIGURE 3 from Wei et al., 2022
response to auditory stimulus decreased magnitude, abnormal	AB + MO1-dusp14	FIGURE 2 from Wei et al., 2022

Phenotype of all Fish created by or utilizing MO1-dusp14

Phenotype	Fish	Conditions	Figures
neuromast support cell decreased amount, abnormal	AB + MO1-dusp14	standard conditions	FIGURE 4 , FIGURE 6 from Wei et al., 2022
response to auditory stimulus decreased magnitude, abnormal	AB + MO1-dusp14	standard conditions	FIGURE 2 from Wei et al., 2022
posterior lateral line neuromast eya1 expression decreased amount, abnormal	AB + MO1-dusp14	standard conditions	FIGURE 3 from Wei et al., 2022
neuromast support cell sox2 expression decreased amount, abnormal	AB + MO1-dusp14	standard conditions	FIGURE 4 from Wei et al., 2022
auditory receptor cell decreased amount, abnormal	AB + MO1-dusp14	standard conditions	FIGURE 3 , FIGURE 6 from Wei et al., 2022
auditory receptor cell normal amount, ameliorated	AB + MO1-dusp14	chemical treatment by injection: EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor	FIGURE 6 from Wei et al., 2022
neuromast support cell normal amount, ameliorated	AB + MO1-dusp14	chemical treatment by injection: EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor	FIGURE 6 from Wei et al., 2022
neuromast hair cell normal amount, ameliorated	AB + MO1-dusp14	chemical treatment by injection: EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor	FIGURE 6 from Wei et al., 2022
neuromast support cell cell population proliferation decreased occurrence, abnormal	AB + MO1-dusp14	standard conditions	FIGURE 4 , FIGURE 6 from Wei et al., 2022
neuromast hair cell decreased amount, abnormal	AB + MO1-dusp14	standard conditions	FIGURE 3 , FIGURE 6 from Wei et al., 2022
neuromast support cell cell population proliferation normal occurrence, ameliorated	AB + MO1-dusp14	chemical treatment by injection: EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor	FIGURE 6 from Wei et al., 2022

Citations