Morpholino
MO3-chl1a
- ID
- ZDB-MRPHLNO-220329-1
- Name
- MO3-chl1a
- Previous Names
- 
    
        
    
    
        
        - MS1 (1)
 
- Target
- Sequence
- 
    
        
        
    
        
            
                5' - AGCACGACTGAGAGAAATACAAAGA - 3'
                
            
            
                
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- 
    
        
        
    
        
            This MO targets isoforms 1 and 3.
- Genome Resources
- None
                
                    
                        Target Location
                    
                    
                
                
            
        
        
    
        
            
            
    
        
    
    
    
        
        
    
    
    
                
                    
                        Genomic Features
                    
                    
                
                
            
        
        
    
        
            
            
    
    
        
    
No data available
    
        
        
    
    
    
                
                    
                        Expression
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Gene expression in Wild Types + MO3-chl1a
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Phenotype
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Phenotype resulting from MO3-chl1a
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    
                
                    
                        Phenotype of all Fish created by or utilizing MO3-chl1a
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    | Phenotype | Fish | Conditions | Figures | 
|---|---|---|---|
| ventricular system accumulation cerebral spinal fluid, abnormal | AB + MO3-chl1a | control | Fig. 7  from Yang et al., 2020 | 
| ventricular system swollen, abnormal | AB + MO3-chl1a | control | Fig. 7  from Yang et al., 2020 | 
| trunk curled, abnormal | AB + MO3-chl1a | control | Fig. 7  from Yang et al., 2020 | 
| trunk curled, abnormal | AB + MO3-chl1a + MO4-chl1a | control | Fig. 7  from Yang et al., 2020 | 
| ventricular system accumulation cerebral spinal fluid, abnormal | AB + MO3-chl1a + MO4-chl1a | control | Fig. 7  from Yang et al., 2020 | 
| ventricular system swollen, abnormal | AB + MO3-chl1a + MO4-chl1a | control | Fig. 7  from Yang et al., 2020 | 
| Reissner's fiber partially broken, abnormal | sqet33mi2AEt + MO3-chl1a (AB) | control | Fig. 10  from Yang et al., 2020 | 
                
                    
                        Citations
                    
                    
                
                
            
        
        
    
        
            
            
        
        
    
    
    