Morpholino

MO1-mvda

ID
ZDB-MRPHLNO-220318-4
Name
MO1-mvda
Previous Names
  • e3i3 (1)
Target
Sequence
5' - TATGAAAGCCAGGAACATACTTTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mvda
Expressed Gene Anatomy Figures
mvda Fig. 1 with image from Wong et al., 2021
Phenotype
Phenotype resulting from MO1-mvda
Phenotype Fish Figures
caudal fin decreased area, abnormal WT + MO1-mvda Fig. 5 with image from Wong et al., 2021
caudal fin malformed, abnormal WT + MO1-mvda Fig. 5 with image from Wong et al., 2021
caudal fin apoptotic process increased process quality, abnormal WT + MO1-mvda Fig. 5 with image from Wong et al., 2021
caudal vein increased accumulation blood cell, abnormal WT + MO1-mvda Fig. 1 with image from Wong et al., 2021
caudal vein plexus decreased amount, abnormal y1Tg + MO1-mvda Fig. 4 with image from Wong et al., 2021
dorsal aorta angiogenic sprout mislocalised, abnormal y1Tg + MO1-mvda Fig. 4 with image from Wong et al., 2021
eye morphology, abnormal WT + MO1-mvda Fig. 1 with image from Wong et al., 2021
eye apoptotic process increased process quality, abnormal WT + MO1-mvda Fig. 6 with image from Wong et al., 2021
heart apoptotic process increased process quality, abnormal WT + MO1-mvda Fig. 6 with image from Wong et al., 2021
integument bulbous, abnormal WT + MO1-mvda Fig. 1 with image from Wong et al., 2021
intersegmental vessel decreased amount, abnormal y1Tg + MO1-mvda Fig. 4 with image from Wong et al., 2021
intersegmental vessel incomplete structure, abnormal y1Tg + MO1-mvda Fig. 4 with image from Wong et al., 2021
keratinocyte autophagosome increased amount, abnormal WT + MO1-mvda Fig. 3 with image from Wong et al., 2021
keratinocyte cell projection disorganized, abnormal WT + MO1-mvda Fig. 3 with image from Wong et al., 2021
keratinocyte cell projection irregular spatial pattern, abnormal WT + MO1-mvda Fig. 2 with image from Wong et al., 2021
keratinocyte cell projection shape, abnormal WT + MO1-mvda Fig. 2 with image from Wong et al., 2021
keratinocyte cell-cell junction hypotrophic, abnormal WT + MO1-mvda Fig. 2 with image from Wong et al., 2021
keratinocyte cell-cell junction ruptured, abnormal WT + MO1-mvda Fig. 3 with image from Wong et al., 2021
keratinocyte keratin filament disorganized, abnormal WT + MO1-mvda Fig. 3 with image from Wong et al., 2021
keratinocyte mitochondrion swollen, abnormal WT + MO1-mvda Fig. 3 with image from Wong et al., 2021
keratinocyte mitophagy increased process quality, abnormal WT + MO1-mvda Fig. 3 with image from Wong et al., 2021
keratinocyte rough endoplasmic reticulum distended, abnormal WT + MO1-mvda Fig. 3 with image from Wong et al., 2021
keratinocyte vesicle increased amount, abnormal WT + MO1-mvda Fig. 3 with image from Wong et al., 2021
pericardium edematous, abnormal WT + MO1-mvda Fig. 1 with image from Wong et al., 2021
trunk angiogenesis decreased process quality, abnormal y1Tg + MO1-mvda Fig. 4 with image from Wong et al., 2021
ventricular system increased accumulation cerebral spinal fluid, abnormal WT + MO1-mvda Fig. 1 with image from Wong et al., 2021
Phenotype of all Fish created by or utilizing MO1-mvda
Phenotype Fish Conditions Figures
keratinocyte cell projection irregular spatial pattern, abnormal WT + MO1-mvda control Fig. 2 with image from Wong et al., 2021
caudal vein increased accumulation blood cell, abnormal WT + MO1-mvda control Fig. 1 with image from Wong et al., 2021
keratinocyte cell projection disorganized, abnormal WT + MO1-mvda control Fig. 3 with image from Wong et al., 2021
keratinocyte vesicle increased amount, abnormal WT + MO1-mvda control Fig. 3 with image from Wong et al., 2021
keratinocyte autophagosome increased amount, abnormal WT + MO1-mvda control Fig. 3 with image from Wong et al., 2021
eye morphology, abnormal WT + MO1-mvda control Fig. 1 with image from Wong et al., 2021
caudal fin apoptotic process increased process quality, abnormal WT + MO1-mvda control Fig. 5 with image from Wong et al., 2021
keratinocyte cell projection shape, abnormal WT + MO1-mvda control Fig. 2 with image from Wong et al., 2021
keratinocyte cell-cell junction hypotrophic, abnormal WT + MO1-mvda control Fig. 2 with image from Wong et al., 2021
ventricular system increased accumulation cerebral spinal fluid, abnormal WT + MO1-mvda control Fig. 1 with image from Wong et al., 2021
caudal fin decreased area, abnormal WT + MO1-mvda control Fig. 5 with image from Wong et al., 2021
keratinocyte rough endoplasmic reticulum distended, abnormal WT + MO1-mvda control Fig. 3 with image from Wong et al., 2021
heart apoptotic process increased process quality, abnormal WT + MO1-mvda control Fig. 6 with image from Wong et al., 2021
keratinocyte cell-cell junction ruptured, abnormal WT + MO1-mvda control Fig. 3 with image from Wong et al., 2021
caudal fin malformed, abnormal WT + MO1-mvda control Fig. 5 with image from Wong et al., 2021
eye apoptotic process increased process quality, abnormal WT + MO1-mvda control Fig. 6 with image from Wong et al., 2021
integument bulbous, abnormal WT + MO1-mvda control Fig. 1 with image from Wong et al., 2021
keratinocyte mitochondrion swollen, abnormal WT + MO1-mvda control Fig. 3 with image from Wong et al., 2021
keratinocyte keratin filament disorganized, abnormal WT + MO1-mvda control Fig. 3 with image from Wong et al., 2021
keratinocyte mitophagy increased process quality, abnormal WT + MO1-mvda control Fig. 3 with image from Wong et al., 2021
pericardium edematous, abnormal WT + MO1-mvda control Fig. 1 with image from Wong et al., 2021
dorsal aorta angiogenic sprout mislocalised, abnormal y1Tg + MO1-mvda control Fig. 4 with image from Wong et al., 2021
caudal vein plexus decreased amount, abnormal y1Tg + MO1-mvda control Fig. 4 with image from Wong et al., 2021
intersegmental vessel decreased amount, abnormal y1Tg + MO1-mvda control Fig. 4 with image from Wong et al., 2021
intersegmental vessel incomplete structure, abnormal y1Tg + MO1-mvda control Fig. 4 with image from Wong et al., 2021
trunk angiogenesis decreased process quality, abnormal y1Tg + MO1-mvda control Fig. 4 with image from Wong et al., 2021
Citations