Morpholino
MO1-chl1a
- ID
- ZDB-MRPHLNO-211026-3
- Name
- MO1-chl1a
- Previous Names
- None
- Target
- Sequence
-
5' - CACTGAGACTCCTGAGCCCCCTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-chl1a
No data available
Phenotype
Phenotype resulting from MO1-chl1a
Phenotype of all Fish created by or utilizing MO1-chl1a
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| ventricular system accumulation cerebral spinal fluid, abnormal | AB + MO1-chl1a | control |
Fig. 7 
from Yang et al., 2020 |
| pericardium edematous, abnormal | AB + MO1-chl1a | control |
Fig. 7
from Yang et al., 2020 |
| trunk curled, abnormal | AB + MO1-chl1a | control |
Fig. 7
from Yang et al., 2020 |
| ventricular system swollen, abnormal | AB + MO1-chl1a | control |
Fig. 7
from Yang et al., 2020 |
| Reissner's fiber absent, abnormal | sqet27Et + MO1-chl1a (AB) | control |
Fig. 9
from Yang et al., 2020 |
| subcommissural organ morphology, abnormal | sqet33mi2AEt + MO1-chl1a (AB) | control |
Fig. 10
from Yang et al., 2020 |
| Reissner's fiber absent, abnormal | sqet33mi2AEt + MO1-chl1a (AB) | control |
Fig. 10
from Yang et al., 2020 |
Citations