Morpholino

MO2-hoxb5b

ID
ZDB-MRPHLNO-210430-1
Name
MO2-hoxb5b
Previous Names
None
Target
Sequence
5' - GATCTTGGTCGTTAAAATCCAGCGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-hoxb5b
Expressed Gene Anatomy Figures
fam168a Fig. 6 from Zhang et al., 2020
fam168b Fig. 6 from Zhang et al., 2020
mbpa Fig. 2 from Zhang et al., 2020
plp1a Fig. 2 from Zhang et al., 2020
pou3f1 Fig. 6 from Zhang et al., 2020
Phenotype
Phenotype resulting from MO2-hoxb5b
Phenotype Fish Figures
brain hypoplastic, abnormal WT + MO2-hoxb5b Fig. 2 from Zhang et al., 2020
central nervous system axon decreased length, abnormal vu19Tg + MO2-hoxb5b Fig. 2 from Zhang et al., 2020
eye hypoplastic, abnormal WT + MO2-hoxb5b Fig. 2 from Zhang et al., 2020
spinal cord plp1a expression decreased amount, abnormal WT + MO2-hoxb5b Fig. 2 from Zhang et al., 2020
spinal cord mbpa expression decreased amount, abnormal WT + MO2-hoxb5b Fig. 2 from Zhang et al., 2020
trunk morphology, abnormal WT + MO2-hoxb5b Fig. 2 from Zhang et al., 2020
whole organism decreased size, abnormal WT + MO2-hoxb5b Fig. 2 from Zhang et al., 2020
whole organism pou3f1 expression increased amount, abnormal WT + MO2-hoxb5b Fig. 6 from Zhang et al., 2020
whole organism fam168b expression increased amount, abnormal WT + MO2-hoxb5b Fig. 6 from Zhang et al., 2020
whole organism fam168a expression increased amount, abnormal WT + MO2-hoxb5b Fig. 6 from Zhang et al., 2020
Phenotype of all Fish created by or utilizing MO2-hoxb5b
Phenotype Fish Conditions Figures
spinal cord plp1a expression decreased amount, abnormal WT + MO2-hoxb5b standard conditions Fig. 2 from Zhang et al., 2020
whole organism pou3f1 expression increased amount, abnormal WT + MO2-hoxb5b standard conditions Fig. 6 from Zhang et al., 2020
whole organism decreased size, abnormal WT + MO2-hoxb5b standard conditions Fig. 2 from Zhang et al., 2020
trunk morphology, abnormal WT + MO2-hoxb5b standard conditions Fig. 2 from Zhang et al., 2020
whole organism fam168b expression increased amount, abnormal WT + MO2-hoxb5b standard conditions Fig. 6 from Zhang et al., 2020
whole organism fam168a expression increased amount, abnormal WT + MO2-hoxb5b standard conditions Fig. 6 from Zhang et al., 2020
spinal cord mbpa expression decreased amount, abnormal WT + MO2-hoxb5b standard conditions Fig. 2 from Zhang et al., 2020
brain hypoplastic, abnormal WT + MO2-hoxb5b standard conditions Fig. 2 from Zhang et al., 2020
eye hypoplastic, abnormal WT + MO2-hoxb5b standard conditions Fig. 2 from Zhang et al., 2020
central nervous system axon decreased length, abnormal vu19Tg + MO2-hoxb5b standard conditions Fig. 2 from Zhang et al., 2020
chordate embryonic development disrupted, abnormal WT + CRISPR1-fam168a + CRISPR1-fam168b + MO1-pou3f1 + MO2-hoxb5b standard conditions Fig. 6 from Zhang et al., 2020
central nervous system mbpa expression decreased amount, abnormal WT + CRISPR1-fam168a + CRISPR1-fam168b + MO1-pou3f1 + MO2-hoxb5b standard conditions Fig. 6 from Zhang et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.