Morpholino

MO1-mir-ntu1

ID
ZDB-MRPHLNO-210311-1
Name
MO1-mir-ntu1
Previous Names
None
Target
Sequence
5' - GAGGCGTTCAGTCATAATCCCGCAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir-ntu1
Expressed Gene Anatomy Figures
dll4 Fig. 5 from Shi et al., 2019
mib1 Fig. 5 from Shi et al., 2019
mir-ntu1 Fig. 2 from Shi et al., 2019
Phenotype
Phenotype resulting from MO1-mir-ntu1
Phenotype Fish Figures
blood vessel dll4 expression increased amount, abnormal WT + MO1-mir-ntu1 Fig. 5 from Shi et al., 2019
blood vessel mib1 expression increased amount, abnormal WT + MO1-mir-ntu1 Fig. 5 from Shi et al., 2019
endothelial tip cell endothelial cell proliferation decreased occurrence, abnormal s843Tg + MO1-mir-ntu1 Fig. 3 from Shi et al., 2019
endothelial tip cell filopodium decreased amount, abnormal y1Tg + MO1-mir-ntu1 Fig. 3 from Shi et al., 2019
endothelial tip cell filopodium decreased length, abnormal y1Tg + MO1-mir-ntu1 Fig. 3 from Shi et al., 2019
intersegmental vessel decreased length, abnormal s843Tg + MO1-mir-ntu1 Fig. 3 from Shi et al., 2019
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal y7Tg + MO1-mir-ntu1 Fig. 3 from Shi et al., 2019
intersegmental vessel endothelial tip cell decreased cellular motility, abnormal s843Tg + MO1-mir-ntu1 Fig. 3 from Shi et al., 2019
intersegmental vessel endothelial tip cell decreased speed, abnormal s843Tg + MO1-mir-ntu1 Fig. 3 from Shi et al., 2019
intersegmental vessel positive regulation of Notch signaling pathway increased magnitude, abnormal zf3185Tg + MO1-mir-ntu1 Fig. 5 from Shi et al., 2019
whole organism mir-ntu1 expression decreased amount, abnormal WT + MO1-mir-ntu1 Fig. 2 from Shi et al., 2019
whole organism dll4 expression increased amount, abnormal WT + MO1-mir-ntu1 Fig. 5 from Shi et al., 2019
whole organism mib1 expression increased amount, abnormal WT + MO1-mir-ntu1 Fig. 5 from Shi et al., 2019
Phenotype of all Fish created by or utilizing MO1-mir-ntu1
Phenotype Fish Conditions Figures
blood vessel dll4 expression increased amount, abnormal WT + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
whole organism mib1 expression increased amount, abnormal WT + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
whole organism mir-ntu1 expression decreased amount, abnormal WT + MO1-mir-ntu1 standard conditions Fig. 2 from Shi et al., 2019
blood vessel mib1 expression increased amount, abnormal WT + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
whole organism dll4 expression increased amount, abnormal WT + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
intersegmental vessel endothelial tip cell decreased speed, abnormal s843Tg + MO1-mir-ntu1 standard conditions Fig. 3 from Shi et al., 2019
endothelial tip cell endothelial cell proliferation decreased occurrence, abnormal s843Tg + MO1-mir-ntu1 standard conditions Fig. 3 from Shi et al., 2019
intersegmental vessel endothelial tip cell decreased cellular motility, abnormal s843Tg + MO1-mir-ntu1 standard conditions Fig. 3 from Shi et al., 2019
intersegmental vessel decreased length, abnormal s843Tg + MO1-mir-ntu1 standard conditions Fig. 3 from Shi et al., 2019
endothelial tip cell filopodium decreased amount, abnormal y1Tg + MO1-mir-ntu1 standard conditions Fig. 3 from Shi et al., 2019
endothelial tip cell filopodium decreased length, abnormal y1Tg + MO1-mir-ntu1 standard conditions Fig. 3 from Shi et al., 2019
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal y7Tg + MO1-mir-ntu1 standard conditions Fig. 3 from Shi et al., 2019
intersegmental vessel positive regulation of Notch signaling pathway increased magnitude, abnormal zf3185Tg + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
intersegmental vessel blood vessel endothelial cell normal amount, ameliorated s916Tg; y7Tg + MO1-mir-ntu1 chemical treatment by environment: DAPT Fig. 5 from Shi et al., 2019
intersegmental vessel normal length, ameliorated s916Tg; y7Tg + MO1-mir-ntu1 chemical treatment by environment: DAPT Fig. 5 from Shi et al., 2019
intersegmental vessel decreased length, abnormal s916Tg; y7Tg + MO1-mir-ntu1 standard conditions Fig. 2,  Fig. 5 from Shi et al., 2019
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal s916Tg; y7Tg + MO1-mir-ntu1 standard conditions Fig. 2,  Fig. 5 from Shi et al., 2019
intersegmental vessel normal length, ameliorated s916Tg; y7Tg + MO1-dll4 + MO1-mib1 + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
intersegmental vessel blood vessel endothelial cell normal amount, ameliorated s916Tg; y7Tg + MO1-dll4 + MO1-mib1 + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.