Morpholino

MO1-si:ch73-1a9.3

ID
ZDB-MRPHLNO-200812-1
Name
MO1-si:ch73-1a9.3
Previous Names
None
Target
Sequence
5' - GAAACCAATGCGCTACTTACTTTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-si:ch73-1a9.3
No data available
Phenotype
Phenotype resulting from MO1-si:ch73-1a9.3
Phenotype of all Fish created by or utilizing MO1-si:ch73-1a9.3
Phenotype Fish Conditions Figures
trunk anterior-posterior axis increased curvature, abnormal WT + MO1-si:ch73-1a9.3 standard conditions Fig. 2 from Gao et al., 2019
eye decreased size, abnormal WT + MO1-si:ch73-1a9.3 standard conditions Fig. 2 from Gao et al., 2019
whole organism decreased length, abnormal WT + MO1-si:ch73-1a9.3 standard conditions Fig. 2 from Gao et al., 2019
whole organism decreased length, abnormal WT + MO1-si:ch73-1a9.3 + MO2-si:ch73-1a9.3 standard conditions Fig. 2 from Gao et al., 2019
whole organism olig2 expression decreased amount, abnormal WT + MO1-si:ch73-1a9.3 + MO2-si:ch73-1a9.3 standard conditions Fig. 8 from Gao et al., 2019
eye decreased size, abnormal WT + MO1-si:ch73-1a9.3 + MO2-si:ch73-1a9.3 standard conditions Fig. 2 from Gao et al., 2019
trunk anterior-posterior axis increased curvature, abnormal WT + MO1-si:ch73-1a9.3 + MO2-si:ch73-1a9.3 standard conditions Fig. 2 from Gao et al., 2019
CaP motoneuron morphology, abnormal ml2Tg + MO1-si:ch73-1a9.3 + MO2-si:ch73-1a9.3 standard conditions Fig. 5 from Gao et al., 2019
CaP motoneuron axon disorganized, abnormal ml2Tg + MO1-si:ch73-1a9.3 + MO2-si:ch73-1a9.3 standard conditions Fig. 6 from Gao et al., 2019
CaP motoneuron axon decreased length, abnormal ml2Tg + MO1-si:ch73-1a9.3 + MO2-si:ch73-1a9.3 standard conditions Fig. 5 from Gao et al., 2019
CaP motoneuron axonogenesis disrupted, abnormal ml2Tg + MO1-si:ch73-1a9.3 + MO2-si:ch73-1a9.3 standard conditions Fig. 5 from Gao et al., 2019
brain DsRed expression decreased amount, abnormal vu19Tg + MO1-si:ch73-1a9.3 + MO2-si:ch73-1a9.3 standard conditions Fig. 8 from Gao et al., 2019
spinal cord DsRed expression decreased amount, abnormal vu19Tg + MO1-si:ch73-1a9.3 + MO2-si:ch73-1a9.3 standard conditions Fig. 8 from Gao et al., 2019
Citations