Morpholino
MO1-gan
- ID
- ZDB-MRPHLNO-200528-1
- Name
- MO1-gan
- Previous Names
-
- ex2-3 (1)
- Target
- Sequence
-
5' - AGAGTGATCTACAGAAGGAAACAGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gan
No data available
Phenotype
Phenotype resulting from MO1-gan
1 - 5 of 30 Show all
Phenotype of all Fish created by or utilizing MO1-gan
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
somite U-shaped, abnormal | AB + MO1-gan | control |
Fig. 4
from Arribat et al., 2019 |
neuromuscular junction development arrested, abnormal | AB + MO1-gan | control |
Fig. 2
from Arribat et al., 2019 |
RoP motor neuron znp-1 labeling decreased distribution, abnormal | AB + MO1-gan | control |
Fig. 2
from Arribat et al., 2019 |
MiP motor neuron axon znp-1 labeling decreased distribution, abnormal | AB + MO1-gan | control |
Fig. 2
from Arribat et al., 2019 |
primary motor neuron axon irregular spatial pattern, abnormal | AB + MO1-gan | control |
Fig. 2
from Arribat et al., 2019 |
1 - 5 of 37 Show all
Citations
- Lescouzères, L., Hassen-Khodja, C., Baudot, A., Bordignon, B., Bomont, P. (2023) A multilevel screening pipeline in zebrafish identifies therapeutic drugs for GAN. EMBO Molecular Medicine. 15(7):e16267
- Arribat, Y., Mysiak, K.S., Lescouzères, L., Boizot, A., Ruiz, M., Rossel, M., Bomont, P. (2019) Sonic Hedgehog repression underlies gigaxonin mutation-induced motor deficits in giant axonal neuropathy. The Journal of Clinical Investigation. 129(12):5312-5326
1 - 2 of 2
Show