Morpholino

MO1-adpgk

ID
ZDB-MRPHLNO-200407-1
Name
MO1-adpgk
Previous Names
  • exon 2 and intron 2 junction (1)
Target
Sequence
5' - GTGTTCTCCAAGTTGCTCACCCCAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adpgk
Expressed Gene Anatomy Figures
bbc3 Figure 5 with image from Imle et al., 2019
bcl2l1 Figure 5 with image from Imle et al., 2019
cdkn1a Figure 5 with image from Imle et al., 2019
gadd45aa Figure 5 with image from Imle et al., 2019
ins Figure 6 with image from Imle et al., 2019
Phenotype
Phenotype resulting from MO1-adpgk
Phenotype Fish Figures
carbohydrate derivative metabolic process decreased occurrence, abnormal AB + MO1-adpgk Fig. S2 from Imle et al., 2019
respiratory electron transport chain process quality, abnormal AB + MO1-adpgk Fig. S2 from Imle et al., 2019
somite shape, abnormal AB + MO1-adpgk Figure 5 with image from Imle et al., 2019
whole organism ins expression decreased amount, abnormal AB + MO1-adpgk Figure 6 with image from Imle et al., 2019
whole organism bcl2l1 expression decreased amount, abnormal AB + MO1-adpgk Figure 5 with image from Imle et al., 2019
whole organism decreased length, abnormal AB + MO1-adpgk + MO4-tp53 Fig. S2,  Figure 5 with image from Imle et al., 2019
whole organism dorsalized, abnormal AB + MO1-adpgk Fig. S2,  Figure 5 with image from Imle et al., 2019
whole organism gadd45aa expression increased amount, abnormal AB + MO1-adpgk Figure 5 with image from Imle et al., 2019
whole organism cdkn1a expression increased amount, abnormal AB + MO1-adpgk Figure 5 with image from Imle et al., 2019
whole organism bbc3 expression increased amount, abnormal AB + MO1-adpgk Figure 5 with image from Imle et al., 2019
whole organism morphology, abnormal AB + MO1-adpgk Figure 5 with image from Imle et al., 2019
whole organism apoptotic process increased occurrence, abnormal AB + MO1-adpgk Figure 5 with image from Imle et al., 2019
whole organism cell death increased occurrence, abnormal AB + MO1-adpgk Fig. S2 from Imle et al., 2019
whole organism glucose decreased amount, abnormal AB + MO1-adpgk Figure 6 with image from Imle et al., 2019
Phenotype of all Fish created by or utilizing MO1-adpgk
Phenotype Fish Conditions Figures
whole organism glucose decreased amount, abnormal AB + MO1-adpgk standard conditions Figure 6 with image from Imle et al., 2019
whole organism ins expression decreased amount, abnormal AB + MO1-adpgk standard conditions Figure 6 with image from Imle et al., 2019
whole organism morphology, abnormal AB + MO1-adpgk standard conditions Figure 5 with image from Imle et al., 2019
whole organism bcl2l1 expression decreased amount, abnormal AB + MO1-adpgk standard conditions Figure 5 with image from Imle et al., 2019
respiratory electron transport chain process quality, abnormal AB + MO1-adpgk standard conditions Fig. S2 from Imle et al., 2019
whole organism cell death increased occurrence, abnormal AB + MO1-adpgk standard conditions Fig. S2 from Imle et al., 2019
whole organism bbc3 expression increased amount, abnormal AB + MO1-adpgk standard conditions Figure 5 with image from Imle et al., 2019
carbohydrate derivative metabolic process decreased occurrence, abnormal AB + MO1-adpgk standard conditions Fig. S2 from Imle et al., 2019
somite shape, abnormal AB + MO1-adpgk standard conditions Figure 5 with image from Imle et al., 2019
whole organism cdkn1a expression increased amount, abnormal AB + MO1-adpgk standard conditions Figure 5 with image from Imle et al., 2019
whole organism decreased length, abnormal AB + MO1-adpgk standard conditions Fig. S2,  Figure 5 with image from Imle et al., 2019
whole organism apoptotic process increased occurrence, abnormal AB + MO1-adpgk standard conditions Figure 5 with image from Imle et al., 2019
whole organism dorsalized, abnormal AB + MO1-adpgk standard conditions Fig. S2,  Figure 5 with image from Imle et al., 2019
whole organism gadd45aa expression increased amount, abnormal AB + MO1-adpgk standard conditions Figure 5 with image from Imle et al., 2019
whole organism decreased length, abnormal AB + MO1-adpgk + MO4-tp53 standard conditions Fig. S2 from Imle et al., 2019
whole organism dorsalized, abnormal AB + MO1-adpgk + MO4-tp53 standard conditions Fig. S2 from Imle et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.