Morpholino
MO1-ttc19
- ID
- ZDB-MRPHLNO-200124-4
- Name
- MO1-ttc19
- Previous Names
- None
- Target
- Sequence
-
5' - AAGGCTGATGTGAAAGCAAATCTGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ttc19
No data available
Phenotype
Phenotype resulting from MO1-ttc19
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO1-ttc19
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
whole organism decreased length, abnormal | WT + MO1-ttc19 | control |
Fig. 3 ![]() |
whole organism decreased pigmentation, abnormal | WT + MO1-ttc19 | control |
Fig. 3 ![]() |
aerobic respiration decreased occurrence, abnormal | WT + MO1-ttc19 | control |
Fig. 3 ![]() |
splanchnocranium morphology, abnormal | WT + MO1-ttc19 | control |
Fig. 3 ![]() |
caudal fin morphology, abnormal | WT + MO1-ttc19 | control |
Fig. 3 ![]() |
1 - 5 of 11 Show all
Citations
- Peruzzo, R., Corrà, S., Costa, R., Brischigliaro, M., Varanita, T., Biasutto, L., Rampazzo, C., Ghezzi, D., Leanza, L., Zoratti, M., Zeviani, M., De Pittà, C., Viscomi, C., Costa, R., Szabò, I. (2021) Exploiting pyocyanin to treat mitochondrial disease due to respiratory complex III dysfunction. Nature communications. 12:2103
- Costa, R., Peruzzo, R., Bachmann, M., Montà, G.D., Vicario, M., Santinon, G., Mattarei, A., Moro, E., Quintana-Cabrera, R., Scorrano, L., Zeviani, M., Vallese, F., Zoratti, M., Paradisi, C., Argenton, F., Brini, M., Calì, T., Dupont, S., Szabò, I., Leanza, L. (2019) Impaired Mitochondrial ATP Production Downregulates Wnt Signaling via ER Stress Induction. Cell Reports. 28:1949-1960.e6
1 - 2 of 2
Show