Morpholino

MO1-ttc19

ID
ZDB-MRPHLNO-200124-4
Name
MO1-ttc19
Previous Names
None
Target
Sequence
5' - AAGGCTGATGTGAAAGCAAATCTGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ttc19
No data available
Phenotype
Phenotype resulting from MO1-ttc19
Phenotype of all Fish created by or utilizing MO1-ttc19
Phenotype Fish Conditions Figures
whole organism length, ameliorated TU + MO1-ttc19 chemical treatment by environment: pyocyanine Fig. 1 with image from Peruzzo et al., 2021
post-vent region malformed, abnormal TU + MO1-ttc19 control Fig. 1 with image from Peruzzo et al., 2021
thigmotaxis decreased process quality, abnormal TU + MO1-ttc19 control Fig. 1 with image from Peruzzo et al., 2021
thigmotaxis process quality, ameliorated TU + MO1-ttc19 chemical treatment by environment: pyocyanine Fig. 1 with image from Peruzzo et al., 2021
aerobic respiration occurrence, ameliorated TU + MO1-ttc19 chemical treatment by environment: pyocyanine Fig. 1 with image from Peruzzo et al., 2021
post-vent region morphology, ameliorated TU + MO1-ttc19 chemical treatment by environment: pyocyanine Fig. 1 with image from Peruzzo et al., 2021
whole organism decreased length, abnormal TU + MO1-ttc19 control Fig. 1 with image from Peruzzo et al., 2021
aerobic respiration decreased occurrence, abnormal TU + MO1-ttc19 control Fig. 1 with image from Peruzzo et al., 2021
whole organism decreased length, abnormal WT + MO1-ttc19 control Fig. 3 with image from Costa et al., 2019
aerobic respiration decreased occurrence, abnormal WT + MO1-ttc19 control Fig. 3 with image from Costa et al., 2019
caudal fin morphology, abnormal WT + MO1-ttc19 control Fig. 3 with image from Costa et al., 2019
whole organism decreased pigmentation, abnormal WT + MO1-ttc19 control Fig. 3 with image from Costa et al., 2019
splanchnocranium morphology, abnormal WT + MO1-ttc19 control Fig. 3 with image from Costa et al., 2019
whole organism decreased length, abnormal ia4Tg + MO1-ttc19 control Fig. 4 with image from Costa et al., 2019
whole organism GFP expression decreased amount, abnormal ia4Tg + MO1-ttc19 control Fig. 3 with image,  Fig. 4 with image from Costa et al., 2019
canonical Wnt signaling pathway decreased occurrence, abnormal ia4Tg + MO1-ttc19 control Fig. 3 with image,  Fig. 4 with image from Costa et al., 2019
whole organism length, ameliorated ia4Tg + MO1-ttc19 chemical treatment by injection: creatine Fig. 4 with image from Costa et al., 2019
canonical Wnt signaling pathway occurrence, ameliorated ia4Tg + MO1-ttc19 chemical treatment by injection: creatine Fig. 4 with image from Costa et al., 2019
whole organism GFP expression amount, ameliorated ia4Tg + MO1-ttc19 chemical treatment by injection: creatine Fig. 4 with image from Costa et al., 2019
Citations