Morpholino

MO3-kat7b

ID

ZDB-MRPHLNO-180731-2

Name

MO3-kat7b

Previous Names

None

Target

Sequence

5' - TGAGCTGTGTGTTTTTACCTTGAGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-kat7b

Expressed Gene	Anatomy	Figures
kat7b	whole organism	Fig. 11 from Yan et al., 2018

Phenotype

Phenotype resulting from MO3-kat7b

Phenotype	Fish	Figures
blood accumulation yolk, abnormal	s843Tg; sd2Tg + MO3-kat7b	Fig. 12 from Yan et al., 2018
blood accumulation trunk, abnormal	s843Tg; sd2Tg + MO3-kat7b	Fig. 12 from Yan et al., 2018
brain hemorrhagic, abnormal	s843Tg; sd2Tg + MO3-kat7b	Fig. 12 from Yan et al., 2018
caudal vein blood circulation decreased efficacy, abnormal	s843Tg; sd2Tg + MO3-kat7b	Fig. 12 from Yan et al., 2018
dorsal aorta blood circulation decreased efficacy, abnormal	s843Tg; sd2Tg + MO3-kat7b	Fig. 12 from Yan et al., 2018
intersegmental vessel blood circulation decreased efficacy, abnormal	s843Tg; sd2Tg + MO3-kat7b	Fig. 12 from Yan et al., 2018
intersegmental vessel endothelial cell decreased amount, abnormal	y7Tg + MO3-kat7b	Fig. 13 from Yan et al., 2018
subintestinal vein malformed, abnormal	s843Tg; sd2Tg + MO3-kat7b	Fig. 12 from Yan et al., 2018
whole organism kat7b expression decreased amount, abnormal	y7Tg + MO3-kat7b	Fig. 11 from Yan et al., 2018

Phenotype of all Fish created by or utilizing MO3-kat7b

Phenotype	Fish	Conditions	Figures
whole organism kat7b expression decreased amount, abnormal	y7Tg + MO3-kat7b	standard conditions	Fig. 11 from Yan et al., 2018
intersegmental vessel endothelial cell decreased amount, abnormal	y7Tg + MO3-kat7b	standard conditions	Fig. 13 from Yan et al., 2018
subintestinal vein malformed, abnormal	s843Tg; sd2Tg + MO3-kat7b	standard conditions	Fig. 12 from Yan et al., 2018
blood accumulation yolk, abnormal	s843Tg; sd2Tg + MO3-kat7b	standard conditions	Fig. 12 from Yan et al., 2018
blood accumulation trunk, abnormal	s843Tg; sd2Tg + MO3-kat7b	standard conditions	Fig. 12 from Yan et al., 2018
brain hemorrhagic, abnormal	s843Tg; sd2Tg + MO3-kat7b	standard conditions	Fig. 12 from Yan et al., 2018
dorsal aorta blood circulation decreased efficacy, abnormal	s843Tg; sd2Tg + MO3-kat7b	standard conditions	Fig. 12 from Yan et al., 2018
caudal vein blood circulation decreased efficacy, abnormal	s843Tg; sd2Tg + MO3-kat7b	standard conditions	Fig. 12 from Yan et al., 2018
intersegmental vessel blood circulation decreased efficacy, abnormal	s843Tg; sd2Tg + MO3-kat7b	standard conditions	Fig. 12 from Yan et al., 2018

Citations