Morpholino

MO1-rnf152

ID
ZDB-MRPHLNO-180522-1
Name
MO1-rnf152
Previous Names
None
Target
Sequence
5' - GCTCTGGGACAAGCTATCCATCGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rnf152
Phenotype
Phenotype resulting from MO1-rnf152
Phenotype Fish Figures
brain dlc expression decreased amount, abnormal WT + MO1-rnf152 Fig. S2 with image from Kumar et al., 2017
diencephalon neurod1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 4 with image from Kumar et al., 2017
eye ascl1a expression decreased amount, abnormal WT + MO1-rnf152 Fig. 7 with image from Kumar et al., 2017
eye her4.1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 7 with image from Kumar et al., 2017
eye neurod1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 4 with image from Kumar et al., 2017
eye dld expression decreased amount, abnormal WT + MO1-rnf152 Fig. 5 with image from Kumar et al., 2017
eye notch1a expression decreased amount, abnormal WT + MO1-rnf152 Fig. 6 with image from Kumar et al., 2017
eye decreased diameter, abnormal WT + MO1-rnf152 Fig. 3 with image from Kumar et al., 2017
eye decreased size, abnormal WT + MO1-rnf152 Fig. 3 with image from Kumar et al., 2017
forebrain notch1a expression decreased amount, abnormal WT + MO1-rnf152 Fig. 6 with image from Kumar et al., 2017
forebrain dld expression decreased amount, abnormal WT + MO1-rnf152 Fig. 5 with image from Kumar et al., 2017
hindbrain notch1a expression decreased amount, abnormal WT + MO1-rnf152 Fig. 6 with image from Kumar et al., 2017
hindbrain dld expression decreased amount, abnormal WT + MO1-rnf152 Fig. 5 with image from Kumar et al., 2017
hindbrain her4.1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 7 with image from Kumar et al., 2017
hindbrain notch3 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 6 with image from Kumar et al., 2017
midbrain dld expression decreased amount, abnormal WT + MO1-rnf152 Fig. 5 with image from Kumar et al., 2017
midbrain notch1a expression decreased amount, abnormal WT + MO1-rnf152 Fig. 6 with image from Kumar et al., 2017
midbrain notch3 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 6 with image from Kumar et al., 2017
midbrain ascl1a expression decreased amount, abnormal WT + MO1-rnf152 Fig. 7 with image from Kumar et al., 2017
midbrain hindbrain boundary dld expression decreased amount, abnormal WT + MO1-rnf152 Fig. 5 with image from Kumar et al., 2017
midbrain hindbrain boundary her4.1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 7 with image from Kumar et al., 2017
neural tube decreased width, abnormal WT + MO1-rnf152 Fig. 3 with image from Kumar et al., 2017
pancreatic bud neurod1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 4 with image from Kumar et al., 2017
posterior lateral line ganglion neurod1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 4 with image from Kumar et al., 2017
presumptive neural retina neurod1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 4 with image from Kumar et al., 2017
presumptive neural retina dlc expression increased amount, abnormal WT + MO1-rnf152 Fig. S2 with image from Kumar et al., 2017
rhombomere decreased size, abnormal WT + MO1-rnf152 Fig. 3 with image from Kumar et al., 2017
telencephalon neurod1 expression decreased amount, abnormal WT + MO1-rnf152 Fig. 4 with image from Kumar et al., 2017
Phenotype of all Fish created by or utilizing MO1-rnf152
Phenotype Fish Conditions Figures
midbrain dld expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 5 with image from Kumar et al., 2017
forebrain notch1a expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 6 with image from Kumar et al., 2017
midbrain notch1a expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 6 with image from Kumar et al., 2017
pancreatic bud neurod1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 4 with image from Kumar et al., 2017
forebrain dld expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 5 with image from Kumar et al., 2017
midbrain notch3 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 6 with image from Kumar et al., 2017
telencephalon neurod1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 4 with image from Kumar et al., 2017
brain dlc expression decreased amount, abnormal WT + MO1-rnf152 control Fig. S2 with image from Kumar et al., 2017
neural tube decreased width, abnormal WT + MO1-rnf152 standard conditions Fig. 3 with image from Kumar et al., 2017
eye decreased size, abnormal WT + MO1-rnf152 standard conditions Fig. 3 with image from Kumar et al., 2017
hindbrain notch3 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 6 with image from Kumar et al., 2017
presumptive neural retina dlc expression increased amount, abnormal WT + MO1-rnf152 control Fig. S2 with image from Kumar et al., 2017
eye her4.1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 7 with image from Kumar et al., 2017
eye dld expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 5 with image from Kumar et al., 2017
midbrain ascl1a expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 7 with image from Kumar et al., 2017
midbrain hindbrain boundary dld expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 5 with image from Kumar et al., 2017
posterior lateral line ganglion neurod1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 4 with image from Kumar et al., 2017
hindbrain dld expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 5 with image from Kumar et al., 2017
rhombomere decreased size, abnormal WT + MO1-rnf152 standard conditions Fig. 3 with image from Kumar et al., 2017
hindbrain her4.1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 7 with image from Kumar et al., 2017
eye decreased diameter, abnormal WT + MO1-rnf152 standard conditions Fig. 3 with image from Kumar et al., 2017
eye ascl1a expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 7 with image from Kumar et al., 2017
midbrain hindbrain boundary her4.1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 7 with image from Kumar et al., 2017
presumptive neural retina neurod1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 4 with image from Kumar et al., 2017
eye notch1a expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 6 with image from Kumar et al., 2017
diencephalon neurod1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 4 with image from Kumar et al., 2017
eye neurod1 expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 4 with image from Kumar et al., 2017
hindbrain notch1a expression decreased amount, abnormal WT + MO1-rnf152 control Fig. 6 with image from Kumar et al., 2017
Citations