Morpholino

MO5-mecp2

ID
ZDB-MRPHLNO-171204-1
Name
MO5-mecp2
Previous Names
None
Target
Sequence
5' - CTCACCTCTGCTGACAACAAAATAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-mecp2
Expressed Gene Anatomy Figures
robo2 Fig. 5 with image from Leong et al., 2015
sema3fa Fig. 5 with image from Leong et al., 2015
sema5ba Fig. 5 with image from Leong et al., 2015
Phenotype
Phenotype resulting from MO5-mecp2
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal AB + MO5-mecp2 Fig. 3 with image from Leong et al., 2015
sensory perception of touch disrupted, abnormal AB + MO5-mecp2 Fig. 7 with image from Leong et al., 2015
trigeminal ganglion axon branchiness, abnormal AB + MO5-mecp2 Fig. 1 with image,  Fig. 2 with image from Leong et al., 2015
trigeminal ganglion axon decreased length, abnormal mecp2fh232/fh232 + MO5-mecp2 Fig. 2 with image from Leong et al., 2015
trigeminal ganglion axon arborization disrupted, abnormal mecp2fh232/fh232 + MO5-mecp2 Fig. 1 with image,  Fig. 2 with image from Leong et al., 2015
whole organism robo2 expression decreased amount, abnormal AB + MO5-mecp2 Fig. 5 with image from Leong et al., 2015
whole organism sema5ba expression decreased amount, abnormal AB + MO5-mecp2 Fig. 5 with image from Leong et al., 2015
whole organism sema3fa expression decreased amount, abnormal AB + MO5-mecp2 Fig. 5 with image from Leong et al., 2015
Phenotype of all Fish created by or utilizing MO5-mecp2
Phenotype Fish Conditions Figures
trigeminal ganglion axon decreased length, abnormal mecp2fh232/fh232 + MO5-mecp2 standard conditions Fig. 2 with image from Leong et al., 2015
trigeminal ganglion axon arborization disrupted, abnormal mecp2fh232/fh232 + MO5-mecp2 standard conditions Fig. 2 with image from Leong et al., 2015
trigeminal ganglion axon branchiness, abnormal AB + MO4-tp53 + MO5-mecp2 standard conditions Fig. 2 with image from Leong et al., 2015
trigeminal ganglion axon arborization disrupted, abnormal AB + MO4-tp53 + MO5-mecp2 standard conditions Fig. 2 with image from Leong et al., 2015
whole organism robo2 expression decreased amount, abnormal AB + MO5-mecp2 standard conditions Fig. 5 with image from Leong et al., 2015
trigeminal ganglion axon arborization disrupted, abnormal AB + MO5-mecp2 standard conditions Fig. 1 with image,  Fig. 2 with image from Leong et al., 2015
trigeminal ganglion axon decreased length, abnormal AB + MO5-mecp2 standard conditions Fig. 2 with image from Leong et al., 2015
trigeminal ganglion axon branchiness, abnormal AB + MO5-mecp2 standard conditions Fig. 1 with image,  Fig. 2 with image from Leong et al., 2015
whole organism sema3fa expression decreased amount, abnormal AB + MO5-mecp2 standard conditions Fig. 5 with image from Leong et al., 2015
whole organism sema5ba expression decreased amount, abnormal AB + MO5-mecp2 standard conditions Fig. 5 with image from Leong et al., 2015
apoptotic process increased occurrence, abnormal AB + MO5-mecp2 standard conditions Fig. 3 with image from Leong et al., 2015
sensory perception of touch disrupted, abnormal AB + MO5-mecp2 standard conditions Fig. 7 with image from Leong et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.