Morpholino

MO2-med13b

ID
ZDB-MRPHLNO-161013-2
Name
MO2-med13b
Previous Names
  • med13b-2-Splice (1)
Target
Sequence
5' - AGAACTCATCATCAAAGCGCAGTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-med13b
Expressed Gene Anatomy Figures
fgfr3 Fig. 5 from Utami et al., 2014
isl1a Fig. 4 from Utami et al., 2014
sox10 Fig. 4 from Utami et al., 2014
sp8a Fig. 5 from Utami et al., 2014
Phenotype
Phenotype resulting from MO2-med13b
Phenotype Fish Figures
ceratohyal cartilage deformed, abnormal AB + MO2-med13b Fig. 4 from Utami et al., 2014
ceratohyal cartilage mislocalised posteriorly, abnormal AB + MO2-med13b Fig. 4 from Utami et al., 2014
cranial neural crest cell mislocalised, abnormal AB + MO2-med13b Fig. 4 from Utami et al., 2014
cranial neural crest cell sox10 expression mislocalised, abnormal AB + MO2-med13b Fig. 4 from Utami et al., 2014
diencephalon fgfr3 expression increased amount, abnormal AB + MO2-med13b Fig. 5 from Utami et al., 2014
eye decreased size, abnormal AB + MO2-med13b Fig. 3 from Utami et al., 2014
head hypoplastic, abnormal AB + MO2-med13b Fig. 3 from Utami et al., 2014
hypothalamus isl1a expression decreased amount, abnormal AB + MO2-med13b Fig. 4 from Utami et al., 2014
midbrain hindbrain boundary fgfr3 expression increased amount, abnormal AB + MO2-med13b Fig. 5 from Utami et al., 2014
motor neuron sp8a expression increased amount, abnormal AB + MO2-med13b Fig. 5 from Utami et al., 2014
nervous system development disrupted, abnormal knu3Tg + MO2-med13b Fig. 4 from Utami et al., 2014
neural crest cell migration decreased process quality, abnormal AB + MO2-med13b Fig. 4 from Utami et al., 2014
olfactory placode sp8a expression increased amount, abnormal AB + MO2-med13b Fig. 5 from Utami et al., 2014
optic tectum EGFP expression decreased amount, abnormal knu3Tg + MO2-med13b Fig. 4 from Utami et al., 2014
pericardium edematous, abnormal AB + MO2-med13b Fig. 3 from Utami et al., 2014
retinal ganglion cell isl1a expression absent, abnormal AB + MO2-med13b Fig. 4 from Utami et al., 2014
ventral telencephalon isl1a expression decreased amount, abnormal AB + MO2-med13b Fig. 4 from Utami et al., 2014
whole organism anterior-posterior axis increased curvature, abnormal AB + MO2-med13b Fig. 3 from Utami et al., 2014
Phenotype of all Fish created by or utilizing MO2-med13b
Phenotype Fish Conditions Figures
diencephalon fgfr3 expression increased amount, abnormal AB + MO2-med13b standard conditions Fig. 5 from Utami et al., 2014
olfactory placode sp8a expression increased amount, abnormal AB + MO2-med13b standard conditions Fig. 5 from Utami et al., 2014
eye decreased size, abnormal AB + MO2-med13b standard conditions Fig. 3 from Utami et al., 2014
midbrain hindbrain boundary fgfr3 expression increased amount, abnormal AB + MO2-med13b standard conditions Fig. 5 from Utami et al., 2014
retinal ganglion cell isl1a expression absent, abnormal AB + MO2-med13b standard conditions Fig. 4 from Utami et al., 2014
whole organism anterior-posterior axis increased curvature, abnormal AB + MO2-med13b standard conditions Fig. 3 from Utami et al., 2014
motor neuron sp8a expression increased amount, abnormal AB + MO2-med13b standard conditions Fig. 5 from Utami et al., 2014
neural crest cell migration decreased process quality, abnormal AB + MO2-med13b standard conditions Fig. 4 from Utami et al., 2014
pericardium edematous, abnormal AB + MO2-med13b standard conditions Fig. 3 from Utami et al., 2014
ceratohyal cartilage mislocalised posteriorly, abnormal AB + MO2-med13b standard conditions Fig. 4 from Utami et al., 2014
cranial neural crest cell mislocalised, abnormal AB + MO2-med13b standard conditions Fig. 4 from Utami et al., 2014
hypothalamus isl1a expression decreased amount, abnormal AB + MO2-med13b standard conditions Fig. 4 from Utami et al., 2014
head hypoplastic, abnormal AB + MO2-med13b standard conditions Fig. 3 from Utami et al., 2014
cranial neural crest cell sox10 expression mislocalised, abnormal AB + MO2-med13b standard conditions Fig. 4 from Utami et al., 2014
ceratohyal cartilage deformed, abnormal AB + MO2-med13b standard conditions Fig. 4 from Utami et al., 2014
ventral telencephalon isl1a expression decreased amount, abnormal AB + MO2-med13b standard conditions Fig. 4 from Utami et al., 2014
optic tectum EGFP expression decreased amount, abnormal knu3Tg + MO2-med13b standard conditions Fig. 4 from Utami et al., 2014
nervous system development disrupted, abnormal knu3Tg + MO2-med13b standard conditions Fig. 4 from Utami et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.