Morpholino

MO2-map9

ID
ZDB-MRPHLNO-161007-5
Name
MO2-map9
Previous Names
  • MOex5 (1)
Target
Sequence
5' - ACAACCTGTTTACATAAAAAGGTGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-map9
Expressed Gene Anatomy Figures
aurka Fig. 8 from Fontenille et al., 2014
eomesa Fig. 8 from Fontenille et al., 2014
eomesb Fig. 8 from Fontenille et al., 2014
foxa2 Fig. 8 from Fontenille et al., 2014
gsc Fig. 8 from Fontenille et al., 2014
lft1 Fig. 8 from Fontenille et al., 2014
map9 Fig. 2 with image,  Fig. 8 from Fontenille et al., 2014
plk1 Fig. 8 from Fontenille et al., 2014
plk4 Fig. 8 from Fontenille et al., 2014
sebox Fig. 8 from Fontenille et al., 2014
shha Fig. 8 from Fontenille et al., 2014
smo Fig. 8 from Fontenille et al., 2014
sox17 Fig. 9 with image from Fontenille et al., 2014
sox32 Fig. 8,  Fig. 9 with image from Fontenille et al., 2014
tdgf1 Fig. 8 from Fontenille et al., 2014
Phenotype
Phenotype resulting from MO2-map9
No data available
Phenotype of all Fish created by or utilizing MO2-map9
Phenotype Fish Conditions Figures
pericardium edematous, abnormal slc24a5b1/b1 + MO1-map9 + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
somite shape, abnormal slc24a5b1/b1 + MO1-map9 + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
eye aplastic, abnormal slc24a5b1/b1 + MO1-map9 + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
caudal fin malformed, abnormal slc24a5b1/b1 + MO1-map9 + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
brain hypoplastic, abnormal slc24a5b1/b1 + MO1-map9 + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
whole organism morphology, abnormal slc24a5b1/b1 + MO1-map9 + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
notochord morphology, abnormal slc24a5b1/b1 + MO1-map9 + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
yolk morphology, abnormal slc24a5b1/b1 + MO1-map9 + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
whole organism map9 expression decreased amount, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 2 with image,  Fig. 8 from Fontenille et al., 2014
mitotic metaphase chromosome alignment process quality, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
whole organism plk1 expression increased amount, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
whole organism gsc expression decreased amount, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
mitotic telophase decreased occurrence, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
whole organism shha expression decreased amount, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
growth arrested, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
epiboly arrested, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 7 with image from Fontenille et al., 2014
whole organism smo expression decreased amount, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
whole organism dead, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 4 with image from Fontenille et al., 2014
whole organism aurka expression increased amount, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
mitotic anaphase decreased occurrence, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
cell metaphase plate morphology, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
yolk syncytial layer spindle absent, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 6 with image from Fontenille et al., 2014
whole organism eomesb expression decreased amount, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
cell spindle shape, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
whole organism plk4 expression increased amount, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
whole organism tdgf1 expression increased amount, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
whole organism sebox expression decreased amount, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
mitotic cell cycle decreased occurrence, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
spindle assembly process quality, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
whole organism eomesa expression increased amount, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
cell chromosome morphology, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
yolk microtubule cytoskeleton morphology, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 6 with image from Fontenille et al., 2014
mitotic prophase decreased occurrence, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
whole organism lft1 expression increased amount, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
apoptotic process increased occurrence, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 4 with image from Fontenille et al., 2014
margin sox17 expression decreased distribution, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 9 with image from Fontenille et al., 2014
whole organism foxa2 expression decreased amount, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
whole organism sox32 expression decreased amount, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
margin sox32 expression decreased distribution, abnormal slc24a5b1/b1 + MO2-map9 standard conditions Fig. 9 with image from Fontenille et al., 2014
whole organism dead, abnormal slc24a5b1/b1 + MO11-tp53 + MO2-map9 standard conditions Fig. 4 with image from Fontenille et al., 2014
apoptotic process increased occurrence, abnormal slc24a5b1/b1 + MO11-tp53 + MO2-map9 standard conditions Fig. 4 with image from Fontenille et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.