Morpholino

MO1-sec61a1l

ID
ZDB-MRPHLNO-160907-5
Name
MO1-sec61a1l
Previous Names
  • sec61al2 MO (1)
Target
Sequence
5' - TGCTCATTCAGTAGTACACACCTCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sec61a1l
No data available
Phenotype
Phenotype resulting from MO1-sec61a1l
Phenotype of all Fish created by or utilizing MO1-sec61a1l
Citations