Morpholino

MO1-tpcn2

ID
ZDB-MRPHLNO-160427-2
Name
MO1-tpcn2
Previous Names
  • TPCN2-MO-T (1)
Target
Sequence
5' - CAGCCAGCAGCGGTTCTTCTTCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tpcn2
No data available
Phenotype
Phenotype resulting from MO1-tpcn2
Phenotype Fish Figures
calcium-mediated signaling decreased process quality, abnormal hkz100Tg + MO1-tpcn2 + MO4-tp53 Fig. 1 from Kelu et al., 2015
CaP motoneuron release of sequestered calcium ion into cytosol asynchronous, abnormal nksaigff213aGt; zf415Tg + MO1-tpcn2 + MO4-tp53 Fig. 1 with image from Kelu et al., 2018
CaP motoneuron release of sequestered calcium ion into cytosol occurrence, abnormal nksaigff213aGt; zf415Tg + MO1-tpcn2 + MO4-tp53 Fig. 1 with image from Kelu et al., 2018
myotome decreased width, abnormal WT + MO1-tpcn2 + MO4-tp53 Fig. 3 with image,  Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
slow muscle cell decreased amount, abnormal WT + MO1-tpcn2 + MO4-tp53 Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
slow muscle cell tpcn2 expression decreased amount, abnormal AB + MO1-tpcn2 + MO4-tp53 Fig. 3 from Kelu et al., 2015
slow muscle cell ab-f59 labeling decreased amount, abnormal AB + MO1-tpcn2 + MO4-tp53 Fig. 3 from Kelu et al., 2015
slow muscle cell calcium-mediated signaling process quality, abnormal hkz100Tg + MO1-tpcn2 + MO4-tp53 (AB) Fig. 7 from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal WT + MO1-tpcn2 + MO4-tp53 Fig. 3 with image,  Fig. 6 with image from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal WT + MO1-tpcn2 + MO4-tp53 Fig. 3 with image,  Fig. 6 with image from Kelu et al., 2017
somite U-shaped, abnormal WT + MO1-tpcn2 + MO4-tp53 Fig. 3 with image,  Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
striated muscle cell decreased width, abnormal WT + MO1-tpcn2 + MO4-tp53 Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
striated muscle cell increased length, abnormal WT + MO1-tpcn2 + MO4-tp53 Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
Phenotype of all Fish created by or utilizing MO1-tpcn2
Phenotype Fish Conditions Figures
slow muscle cell ab-f59 labeling decreased amount, abnormal AB + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 3 from Kelu et al., 2015
slow muscle cell tpcn2 expression decreased amount, abnormal AB + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 3 from Kelu et al., 2015
slow muscle cell decreased amount, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 4 with image from Kelu et al., 2017
striated muscle cell decreased width, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 4 with image from Kelu et al., 2017
somite U-shaped, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 3 with image,  Fig. 4 with image from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 3 with image from Kelu et al., 2017
myotome decreased width, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 3 with image,  Fig. 4 with image from Kelu et al., 2017
striated muscle cell increased length, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 4 with image from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 3 with image from Kelu et al., 2017
striated muscle cell width, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
slow muscle cell decreased amount, abnormal WT + MO1-tpcn2 + MO4-tp53 control Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
myotome width, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
striated muscle cell decreased width, abnormal WT + MO1-tpcn2 + MO4-tp53 control Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
striated muscle cell increased length, abnormal WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
somite U-shaped, abnormal WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril organization quality, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
somite U-shaped, abnormal WT + MO1-tpcn2 + MO4-tp53 control Fig. 3 with image,  Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
myotome width, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
striated muscle cell width, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
somite U-shaped, abnormal WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal WT + MO1-tpcn2 + MO4-tp53 control Fig. 3 with image,  Fig. 6 with image from Kelu et al., 2017
striated muscle cell increased length, abnormal WT + MO1-tpcn2 + MO4-tp53 control Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
myotome decreased width, abnormal WT + MO1-tpcn2 + MO4-tp53 control Fig. 3 with image,  Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
slow muscle cell amount, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
striated muscle cell length, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal WT + MO1-tpcn2 + MO4-tp53 control Fig. 3 with image,  Fig. 6 with image from Kelu et al., 2017
slow muscle cell sarcomere morphology, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
slow muscle cell amount, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
calcium-mediated signaling decreased process quality, abnormal hkz100Tg + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 1 from Kelu et al., 2015
slow muscle cell calcium-mediated signaling process quality, ameliorated hkz100Tg + MO1-tpcn2 + MO4-tp53 (AB) chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 7 from Kelu et al., 2017
slow muscle cell calcium-mediated signaling process quality, abnormal hkz100Tg + MO1-tpcn2 + MO4-tp53 (AB) control Fig. 7 from Kelu et al., 2017
slow muscle cell calcium-mediated signaling process quality, ameliorated hkz100Tg + MO1-tpcn2 + MO4-tp53 (AB) chemical treatment by environment: caffeine Fig. 7 from Kelu et al., 2017
CaP motoneuron release of sequestered calcium ion into cytosol asynchronous, abnormal nksaigff213aGt; zf415Tg + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 1 with image from Kelu et al., 2018
CaP motoneuron release of sequestered calcium ion into cytosol occurrence, abnormal nksaigff213aGt; zf415Tg + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 1 with image from Kelu et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.