Morpholino

MO2-vdrb

ID
ZDB-MRPHLNO-160408-3
Name
MO2-vdrb
Previous Names
  • intron2-exon3 junction (1)
Target
Sequence
5' - TCCATCACTAGCAGACGAGGGAAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-vdrb
Expressed Gene Anatomy Figures
pax2a Fig. 3 from Kwon, 2016
pax8 Fig. 3 from Kwon, 2016
Phenotype
Phenotype resulting from MO2-vdrb
Phenotype Fish Figures
brain fsta expression increased amount, abnormal AB + MO2-vdrb + MO4-tp53 Fig. 2 with image from Kwon, 2019
ceratobranchial cartilage decreased size, abnormal AB + MO2-vdrb + MO4-tp53 Fig. 1 with image from Kwon, 2019
cranial cartilage hypoplastic, abnormal AB + MO2-vdrb + MO4-tp53 Fig. 1 with image from Kwon, 2019
cranial cartilage morphology, abnormal AB + MO2-vdrb + MO4-tp53 Fig. 1 with image from Kwon, 2019
eye fsta expression increased amount, abnormal AB + MO2-vdrb + MO4-tp53 Fig. 2 with image from Kwon, 2019
head decreased size, abnormal AB + MO2-vdrb Fig. 2 from Kwon, 2016
heart decreased functionality, abnormal AB + MO2-vdrb + MO4-tp53 Fig. 2 from Kwon, 2016
macula saccule hair cell decreased amount, abnormal s356tTg + MO2-vdrb Fig. 4 from Kwon, 2016
macula utricle hair cell decreased amount, abnormal s356tTg + MO2-vdrb Fig. 4 from Kwon, 2016
Meckel's cartilage absent, abnormal AB + MO2-vdrb + MO4-tp53 Fig. 1 with image from Kwon, 2019
motor behavior disrupted, abnormal s356tTg + MO2-vdrb Fig. 4 from Kwon, 2016
neuromuscular process controlling balance disrupted, abnormal s356tTg + MO2-vdrb Fig. 4 from Kwon, 2016
otic placode pax8 expression decreased amount, abnormal AB + MO2-vdrb Fig. 3 from Kwon, 2016
otic placode pax2a expression decreased amount, abnormal AB + MO2-vdrb Fig. 3 from Kwon, 2016
otic placode pax8 expression decreased distribution, abnormal AB + MO2-vdrb Fig. 3 from Kwon, 2016
otic placode pax2a expression decreased distribution, abnormal AB + MO2-vdrb Fig. 3 from Kwon, 2016
otic vesicle decreased size, abnormal AB + MO2-vdrb Fig. 1,  Fig. 2 from Kwon, 2016
otolith non-functional, abnormal AB + MO2-vdrb Fig. 2 from Kwon, 2016
palatoquadrate cartilage absent, abnormal AB + MO2-vdrb + MO4-tp53 Fig. 1 with image from Kwon, 2019
pericardium edematous, abnormal AB + MO2-vdrb + MO4-tp53 Fig. 1 from Kwon, 2016
pharyngeal arch fsta expression increased amount, abnormal AB + MO2-vdrb + MO4-tp53 Fig. 2 with image from Kwon, 2019
semicircular canal malformed, abnormal AB + MO2-vdrb Fig. 2 from Kwon, 2016
spinal cord fsta expression increased amount, abnormal AB + MO2-vdrb + MO4-tp53 Fig. 2 with image from Kwon, 2019
whole organism decreased pigmentation, abnormal AB + MO2-vdrb Fig. 2 from Kwon, 2016
Phenotype of all Fish created by or utilizing MO2-vdrb
Phenotype Fish Conditions Figures
semicircular canal malformed, abnormal AB + MO2-vdrb standard conditions Fig. 2 from Kwon, 2016
otic vesicle decreased size, abnormal AB + MO2-vdrb standard conditions Fig. 1,  Fig. 2 from Kwon, 2016
otic placode pax2a expression decreased distribution, abnormal AB + MO2-vdrb standard conditions Fig. 3 from Kwon, 2016
otic placode pax8 expression decreased amount, abnormal AB + MO2-vdrb standard conditions Fig. 3 from Kwon, 2016
otolith non-functional, abnormal AB + MO2-vdrb standard conditions Fig. 2 from Kwon, 2016
otic placode pax2a expression decreased amount, abnormal AB + MO2-vdrb standard conditions Fig. 3 from Kwon, 2016
whole organism decreased pigmentation, abnormal AB + MO2-vdrb standard conditions Fig. 2 from Kwon, 2016
otic placode pax8 expression decreased distribution, abnormal AB + MO2-vdrb standard conditions Fig. 3 from Kwon, 2016
head decreased size, abnormal AB + MO2-vdrb standard conditions Fig. 2 from Kwon, 2016
eye fsta expression increased amount, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
spinal cord fsta expression increased amount, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
ceratobranchial cartilage decreased size, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
heart decreased functionality, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 from Kwon, 2016
palatoquadrate cartilage absent, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
brain fsta expression increased amount, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
Meckel's cartilage absent, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
cranial cartilage hypoplastic, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
pharyngeal arch fsta expression increased amount, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
pericardium edematous, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 from Kwon, 2016
cranial cartilage morphology, abnormal AB + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
neuromuscular process controlling balance disrupted, abnormal s356tTg + MO2-vdrb standard conditions Fig. 4 from Kwon, 2016
macula saccule hair cell decreased amount, abnormal s356tTg + MO2-vdrb standard conditions Fig. 4 from Kwon, 2016
macula utricle hair cell decreased amount, abnormal s356tTg + MO2-vdrb standard conditions Fig. 4 from Kwon, 2016
motor behavior disrupted, abnormal s356tTg + MO2-vdrb standard conditions Fig. 4 from Kwon, 2016
eye fsta expression increased amount, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
palatoquadrate cartilage absent, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
spinal cord fsta expression increased amount, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
heart lateralized, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 3 from Kwon, 2016
heart looping process quality, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 3 from Kwon, 2016
ceratobranchial cartilage decreased size, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
heart decreased functionality, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 from Kwon, 2016
brain fsta expression increased amount, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
Meckel's cartilage absent, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
cranial cartilage hypoplastic, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
pharyngeal arch fsta expression increased amount, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 2 with image from Kwon, 2019
pericardium edematous, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 from Kwon, 2016
cardiac ventricle bmp4 expression increased distribution, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 4 from Kwon, 2016
cranial cartilage morphology, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 1 with image from Kwon, 2019
heart jogging process quality, abnormal AB + MO1-vdra + MO2-vdrb + MO4-tp53 standard conditions Fig. 3 from Kwon, 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.