Morpholino

MO4-mmp21

ID
ZDB-MRPHLNO-160208-1
Name
MO4-mmp21
Previous Names
  • exon 3/intron 3 (1)
Target
Sequence
5' - AAATGTGCGATTTAAAACCTGTGCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-mmp21
Phenotype
Phenotype resulting from MO4-mmp21
Phenotype of all Fish created by or utilizing MO4-mmp21
Citations