Morpholino

MO4-mmp21

ID
ZDB-MRPHLNO-160208-1
Name
MO4-mmp21
Previous Names
  • exon 3/intron 3 (1)
Target
Sequence
5' - AAATGTGCGATTTAAAACCTGTGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-mmp21
Expressed Gene Anatomy Figures
her2 Fig. 4 from Perles et al., 2015
her6 Fig. 4 from Perles et al., 2015
her9 Fig. 4 from Perles et al., 2015
her15.1 Fig. 4 from Perles et al., 2015
hey1 Fig. 4 from Perles et al., 2015
mmp21 Fig. 3 with image from Qin et al., 2022
myl7 Fig. 3 with image from Qin et al., 2022
spaw Fig. 2 from Perles et al., 2015
Phenotype
Phenotype resulting from MO4-mmp21
Phenotype Fish Figures
determination of heart left/right asymmetry disrupted, abnormal WT + MO4-mmp21 Fig. 2 from Perles et al., 2015
determination of left/right symmetry disrupted, abnormal WT + MO4-mmp21 Fig. 2 from Perles et al., 2015
heart position, abnormal WT + MO4-mmp21 Fig. 2 from Perles et al., 2015
heart myl7 expression spatial pattern, abnormal AB + MO4-mmp21 Fig. 3 with image from Qin et al., 2022
heart embryonic heart tube left/right pattern formation decreased process quality, abnormal AB + MO4-mmp21 Fig. 3 with image,  Fig. 4 with image from Qin et al., 2022
heart heart looping decreased process quality, abnormal AB + MO4-mmp21 Fig. 3 with image,  Fig. 4 with image from Qin et al., 2022
heart looping disrupted, abnormal WT + MO4-mmp21 Fig. 2 from Perles et al., 2015
mesoderm spaw expression mislocalised, abnormal WT + MO4-mmp21 Fig. 2 from Perles et al., 2015
Notch signaling pathway increased process quality, abnormal WT + MO4-mmp21 Fig. 4 from Perles et al., 2015
whole organism mmp21 expression decreased amount, abnormal AB + MO4-mmp21 Fig. 3 with image from Qin et al., 2022
whole organism hey1 expression increased amount, abnormal WT + MO4-mmp21 Fig. 4 from Perles et al., 2015
whole organism her9 expression increased amount, abnormal WT + MO4-mmp21 Fig. 4 from Perles et al., 2015
whole organism her6 expression increased amount, abnormal WT + MO4-mmp21 Fig. 4 from Perles et al., 2015
whole organism her15.1 expression increased amount, abnormal WT + MO4-mmp21 Fig. 4 from Perles et al., 2015
whole organism her2 expression increased amount, abnormal WT + MO4-mmp21 Fig. 4 from Perles et al., 2015
Phenotype of all Fish created by or utilizing MO4-mmp21
Phenotype Fish Conditions Figures
heart embryonic heart tube left/right pattern formation decreased process quality, abnormal AB + MO4-mmp21 control Fig. 3 with image,  Fig. 4 with image from Qin et al., 2022
whole organism mmp21 expression decreased amount, abnormal AB + MO4-mmp21 control Fig. 3 with image from Qin et al., 2022
heart heart looping decreased process quality, abnormal AB + MO4-mmp21 control Fig. 3 with image,  Fig. 4 with image from Qin et al., 2022
heart myl7 expression spatial pattern, abnormal AB + MO4-mmp21 control Fig. 3 with image from Qin et al., 2022
Notch signaling pathway increased process quality, abnormal WT + MO4-mmp21 standard conditions Fig. 4 from Perles et al., 2015
whole organism her9 expression increased amount, abnormal WT + MO4-mmp21 standard conditions Fig. 4 from Perles et al., 2015
heart looping disrupted, abnormal WT + MO4-mmp21 standard conditions Fig. 2 from Perles et al., 2015
whole organism her15.1 expression increased amount, abnormal WT + MO4-mmp21 standard conditions Fig. 4 from Perles et al., 2015
whole organism her6 expression increased amount, abnormal WT + MO4-mmp21 standard conditions Fig. 4 from Perles et al., 2015
heart position, abnormal WT + MO4-mmp21 standard conditions Fig. 2 from Perles et al., 2015
determination of left/right symmetry disrupted, abnormal WT + MO4-mmp21 standard conditions Fig. 2 from Perles et al., 2015
whole organism her2 expression increased amount, abnormal WT + MO4-mmp21 standard conditions Fig. 4 from Perles et al., 2015
determination of heart left/right asymmetry disrupted, abnormal WT + MO4-mmp21 standard conditions Fig. 2 from Perles et al., 2015
whole organism hey1 expression increased amount, abnormal WT + MO4-mmp21 standard conditions Fig. 4 from Perles et al., 2015
mesoderm spaw expression mislocalised, abnormal WT + MO4-mmp21 standard conditions Fig. 2 from Perles et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.