Morpholino

MO4-atg5

ID
ZDB-MRPHLNO-151021-1
Name
MO4-atg5
Previous Names
None
Target
Sequence
5' - CACATCCTTGTCATCTGCCATTATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-atg5
Phenotype
Phenotype resulting from MO4-atg5
Phenotype Fish Figures
atrioventricular canal tbx2b expression increased distribution, abnormal AB + MO4-atg5 Fig. 5 from Lee et al., 2014
atrioventricular canal tbx2b expression mislocalised, abnormal AB + MO4-atg5 Fig. 5 from Lee et al., 2014
atrium tbx2b expression increased distribution, abnormal AB + MO4-atg5 Fig. 5 from Lee et al., 2014
atrium increased size, abnormal zf155Tg + MO4-atg5 Fig. 3 from Lee et al., 2014
atrium tbx2b expression mislocalised, abnormal AB + MO4-atg5 Fig. 5 from Lee et al., 2014
autophagosome assembly disrupted, abnormal AB + MO4-atg5 Fig. 1 from Lee et al., 2014
cardiac ventricle tbx2b expression increased distribution, abnormal AB + MO4-atg5 Fig. 5 from Lee et al., 2014
cardiac ventricle bmp4 expression mislocalised, abnormal AB + MO4-atg5 Fig. 4 from Lee et al., 2014
cardiac ventricle vcana expression mislocalised, abnormal AB + MO4-atg5 Fig. 4 from Lee et al., 2014
cardiac ventricle tbx2b expression mislocalised, abnormal AB + MO4-atg5 Fig. 5 from Lee et al., 2014
cardiac ventricle notch1b expression mislocalised, abnormal AB + MO4-atg5 Fig. 4 from Lee et al., 2014
cardiac ventricle orientation atrium, abnormal zf155Tg + MO4-atg5 Fig. 3 from Lee et al., 2014
cell autophagosome assembly decreased process quality, abnormal zf155Tg + MO4-atg5 Fig. 1 from Lee et al., 2014
eye decreased size, abnormal AB + MO4-atg5 Fig. 2 from Lee et al., 2014
head decreased size, abnormal AB + MO4-atg5 Fig. 2 from Lee et al., 2014
heart mynn expression increased amount, abnormal AB + MO4-atg5 Fig. S7 from Lee et al., 2014
heart znfl2a expression increased amount, abnormal AB + MO4-atg5 Fig. S7 from Lee et al., 2014
heart her15.1 expression increased amount, abnormal AB + MO4-atg5 Fig. S7 from Lee et al., 2014
heart eed expression increased amount, abnormal AB + MO4-atg5 Fig. S7 from Lee et al., 2014
heart hoxb2a expression increased amount, abnormal AB + MO4-atg5 Fig. S7 from Lee et al., 2014
heart tbx5a expression increased distribution, abnormal AB + MO4-atg5 Fig. 5 from Lee et al., 2014
heart tbx5a expression mislocalised, abnormal AB + MO4-atg5 Fig. 5 from Lee et al., 2014
heart structure, abnormal AB + MO4-atg5 Fig. S1 from Lee et al., 2014
heart autophagosome decreased amount, abnormal zf155Tg + MO4-atg5 Fig. 3Fig. S5 from Lee et al., 2014
heart looping disrupted, abnormal AB + MO4-atg5 Fig. S1 from Lee et al., 2014
heart looping process quality, abnormal AB + MO4-atg5 Fig. 3Fig. 4 from Lee et al., 2014
heart tube linear, abnormal AB + MO4-atg5 Fig. 4 from Lee et al., 2014
pericardium edematous, abnormal zf155Tg + MO4-atg5 Fig. 2Fig. 3 from Lee et al., 2014
post-vent region cell death increased occurrence, abnormal AB + MO4-atg5 Fig. 2 from Lee et al., 2014
pronephric duct cystic, abnormal WIK + MO4-atg5 Fig. 4 from Zhu et al., 2017
pronephros development decreased process quality, abnormal WIK + MO4-atg5 Fig. 4 from Zhu et al., 2017
whole organism bent, abnormal AB + MO4-atg5 Fig. 2 from Lee et al., 2014
whole organism atg5 expression decreased amount, abnormal AB + MO4-atg5 Fig. 1 from Lee et al., 2014
whole organism viability, abnormal AB + MO4-atg5 Fig. S4 from Lee et al., 2014
Phenotype of all Fish created by or utilizing MO4-atg5
Phenotype Fish Conditions Figures
heart hoxb2a expression increased amount, abnormal AB + MO4-atg5 standard conditions Fig. S7 from Lee et al., 2014
eye decreased size, abnormal AB + MO4-atg5 standard conditions Fig. 2 from Lee et al., 2014
whole organism bent, abnormal AB + MO4-atg5 standard conditions Fig. 2 from Lee et al., 2014
heart looping process quality, abnormal AB + MO4-atg5 standard conditions Fig. 4 from Lee et al., 2014
cardiac ventricle bmp4 expression mislocalised, abnormal AB + MO4-atg5 standard conditions Fig. 4 from Lee et al., 2014
atrioventricular canal tbx2b expression increased distribution, abnormal AB + MO4-atg5 standard conditions Fig. 5 from Lee et al., 2014
heart tbx5a expression increased distribution, abnormal AB + MO4-atg5 standard conditions Fig. 5 from Lee et al., 2014
heart mynn expression increased amount, abnormal AB + MO4-atg5 standard conditions Fig. S7 from Lee et al., 2014
autophagosome assembly disrupted, abnormal AB + MO4-atg5 control Fig. 1 from Lee et al., 2014
heart her15.1 expression increased amount, abnormal AB + MO4-atg5 standard conditions Fig. S7 from Lee et al., 2014
heart znfl2a expression increased amount, abnormal AB + MO4-atg5 standard conditions Fig. S7 from Lee et al., 2014
heart eed expression increased amount, abnormal AB + MO4-atg5 standard conditions Fig. S7 from Lee et al., 2014
whole organism atg5 expression decreased amount, abnormal AB + MO4-atg5 control Fig. 1 from Lee et al., 2014
cardiac ventricle notch1b expression mislocalised, abnormal AB + MO4-atg5 standard conditions Fig. 4 from Lee et al., 2014
heart tube linear, abnormal AB + MO4-atg5 standard conditions Fig. 4 from Lee et al., 2014
head decreased size, abnormal AB + MO4-atg5 standard conditions Fig. 2 from Lee et al., 2014
cardiac ventricle vcana expression mislocalised, abnormal AB + MO4-atg5 standard conditions Fig. 4 from Lee et al., 2014
atrium tbx2b expression increased distribution, abnormal AB + MO4-atg5 standard conditions Fig. 5 from Lee et al., 2014
cardiac ventricle tbx2b expression mislocalised, abnormal AB + MO4-atg5 standard conditions Fig. 5 from Lee et al., 2014
whole organism viability, abnormal AB + MO4-atg5 standard conditions Fig. S4 from Lee et al., 2014
cardiac ventricle tbx2b expression increased distribution, abnormal AB + MO4-atg5 standard conditions Fig. 5 from Lee et al., 2014
heart structure, abnormal AB + MO4-atg5 standard conditions Fig. S1 from Lee et al., 2014
post-vent region cell death increased occurrence, abnormal AB + MO4-atg5 standard conditions Fig. 2 from Lee et al., 2014
pericardium edematous, abnormal AB + MO4-atg5 standard conditions Fig. 2 from Lee et al., 2014
atrioventricular canal tbx2b expression mislocalised, abnormal AB + MO4-atg5 standard conditions Fig. 5 from Lee et al., 2014
heart tbx5a expression mislocalised, abnormal AB + MO4-atg5 standard conditions Fig. 5 from Lee et al., 2014
heart looping disrupted, abnormal AB + MO4-atg5 standard conditions Fig. S1 from Lee et al., 2014
atrium tbx2b expression mislocalised, abnormal AB + MO4-atg5 standard conditions Fig. 5 from Lee et al., 2014
pronephros development decreased process quality, abnormal WIK + MO4-atg5 standard conditions Fig. 4 from Zhu et al., 2017
pronephric duct cystic, abnormal WIK + MO4-atg5 standard conditions Fig. 4 from Zhu et al., 2017
heart looping process quality, abnormal zf155Tg + MO4-atg5 standard conditions Fig. 3 from Lee et al., 2014
cell autophagosome assembly decreased process quality, abnormal zf155Tg + MO4-atg5 control Fig. 1 from Lee et al., 2014
atrium increased size, abnormal zf155Tg + MO4-atg5 standard conditions Fig. 3 from Lee et al., 2014
pericardium edematous, abnormal zf155Tg + MO4-atg5 standard conditions Fig. 3 from Lee et al., 2014
cardiac ventricle orientation atrium, abnormal zf155Tg + MO4-atg5 standard conditions Fig. 3 from Lee et al., 2014
heart autophagosome decreased amount, abnormal zf155Tg + MO4-atg5 standard conditions Fig. 3Fig. S5 from Lee et al., 2014
autophagy decreased occurrence, abnormal zf155Tg + MO4-atg5(AB) primary cell culture: blastomere Fig. 1 from Lee et al., 2016
cell autophagosome decreased amount, abnormal zf155Tg + MO4-atg5(AB) primary cell culture: blastomere Fig. 1 from Lee et al., 2016
pronephros development decreased process quality, abnormal pkd1azf1067/zf1067 + MO4-atg5 standard conditions Fig. 4 from Zhu et al., 2017
pronephric duct cystic, exacerbated pkd1azf1067/zf1067 + MO4-atg5 standard conditions Fig. 4 from Zhu et al., 2017
heart physical object quality, abnormal tp53zdf1/zdf1 + MO4-atg5 standard conditions Fig. S3 from Lee et al., 2014
whole organism bent, abnormal tp53zdf1/zdf1 + MO4-atg5 standard conditions Fig. S3 from Lee et al., 2014
whole organism cell death increased occurrence, abnormal tp53zdf1/zdf1 + MO4-atg5 standard conditions Fig. S3 from Lee et al., 2014
head decreased size, abnormal tp53zdf1/zdf1 + MO4-atg5 standard conditions Fig. S3 from Lee et al., 2014
pronephros cystic, exacerbated li1Tg + MO3-pkd2 + MO4-atg5 standard conditions Fig. 7 with image from Chang et al., 2017
pronephros morphogenesis decreased process quality, abnormal li1Tg + MO3-pkd2 + MO4-atg5 standard conditions Fig. 7 with image from Chang et al., 2017
Citations