Morpholino
MO2-inf2
- ID
- ZDB-MRPHLNO-150928-2
- Name
- MO2-inf2
- Previous Names
-
- E3I3 MO (1)
- Target
- Sequence
-
5' - AGAGTTAAGGTCACACTTGCCTTGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-inf2
No data available
Phenotype
Phenotype resulting from MO2-inf2
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO2-inf2
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| glomerular filtration disrupted, abnormal | AB + MO2-inf2 | standard conditions |
Fig. S8
from Schiffer et al., 2015 |
| whole organism decreased life span, abnormal | AB + MO2-inf2 | standard conditions |
Fig. S8
from Schiffer et al., 2015 |
1 - 2 of 2
Citations
- Schiffer, M., Teng, B., Gu, C., Shchedrina, V.A., Kasaikina, M., Pham, V.A., Hanke, N., Rong, S., Gueler, F., Schroder, P., Tossidou, I., Park, J.K., Staggs, L., Haller, H., Erschow, S., Hilfiker-Kleiner, D., Wei, C., Chen, C., Tardi, N., Hakroush, S., Selig, M.K., Vasilyev, A., Merscher, S., Reiser, J., Sever, S. (2015) Pharmacological targeting of actin-dependent dynamin oligomerization ameliorates chronic kidney disease in diverse animal models. Nature medicine. 21:601-9
- Sun, H., Al-Romaih, K.I., MacRae, C.A., Pollak, M.R. (2014) Human Kidney Disease-causing INF2 Mutations Perturb Rho/Dia Signaling in the Glomerulus. EBioMedicine. 1:107-15
1 - 2 of 2
Show