Morpholino
MO2-inf2
- ID
- ZDB-MRPHLNO-150928-2
- Name
- MO2-inf2
- Previous Names
-
- E3I3 MO (1)
- Target
- Sequence
-
5' - AGAGTTAAGGTCACACTTGCCTTGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-inf2
No data available
Phenotype
Phenotype resulting from MO2-inf2
Phenotype of all Fish created by or utilizing MO2-inf2
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| glomerular filtration disrupted, abnormal | AB + MO2-inf2 | standard conditions |
Fig. S8
from Schiffer et al., 2015 |
| whole organism decreased life span, abnormal | AB + MO2-inf2 | standard conditions |
Fig. S8
from Schiffer et al., 2015 |
Citations