Morpholino

MO1-ada2b

ID
ZDB-MRPHLNO-150813-1
Name
MO1-ada2b
Previous Names
  • MO1-cecr1b
  • cecr1b ATG-MO (1)
Target
Sequence
5' - GCTTATGCTACTCATTGCTCCCAGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ada2b
No data available
Phenotype
Phenotype resulting from MO1-ada2b
Phenotype of all Fish created by or utilizing MO1-ada2b
Phenotype Fish Conditions Figures
caudal hematopoietic tissue neutrophil decreased amount, abnormal ump5Tg/ump5Tg + MO1-ada2b + MO2-ada2b standard conditions Fig. 1 with image from Brix et al., 2024
pronephros damaged, abnormal WT + MO1-ada2b ablation: pronephros Figure 2 with image from Gessler et al., 2022
pronephros regeneration decreased occurrence, abnormal WT + MO1-ada2b ablation: pronephros Figure 2 with image from Gessler et al., 2022
pronephros regeneration delayed, abnormal WT + MO1-ada2b ablation: pronephros Figure 2 with image from Gessler et al., 2022
pronephros regeneration decreased rate, abnormal WT + MO1-ada2b ablation: pronephros Figure 2 with image from Gessler et al., 2022
neutrophil decreased amount, abnormal i114Tg + MO1-ada2b standard conditions Fig. S16 from Zhou et al., 2014
cranium hemorrhagic, abnormal sd2Tg; y1Tg + MO1-ada2b standard conditions Fig. 2 from Zhou et al., 2014
blood accumulation hindbrain, abnormal sd2Tg; y1Tg + MO1-ada2b standard conditions Fig. 2 from Kasher et al., 2015
cranial blood vessel hemorrhagic, abnormal sd2Tg; y1Tg + MO1-ada2b standard conditions Fig. S16 from Zhou et al., 2014
brain hemorrhagic, abnormal sd2Tg; y1Tg + MO1-ada2b standard conditions Fig. 2 from Kasher et al., 2015
pronephros damaged, abnormal WT + MO1-ada + MO1-ada2b ablation: pronephros Figure 3 with image from Gessler et al., 2022
pronephros regeneration decreased occurrence, abnormal WT + MO1-ada + MO1-ada2b ablation: pronephros Figure 3 with image from Gessler et al., 2022
pronephros regeneration decreased rate, abnormal WT + MO1-ada + MO1-ada2b ablation: pronephros Figure 3 with image from Gessler et al., 2022
pronephros regeneration delayed, abnormal WT + MO1-ada + MO1-ada2b ablation: pronephros Figure 3 with image from Gessler et al., 2022
pronephros regeneration decreased rate, abnormal WT + MO1-ada2a + MO1-ada2b ablation: pronephros Figure 3 with image from Gessler et al., 2022
pronephros regeneration decreased occurrence, abnormal WT + MO1-ada2a + MO1-ada2b ablation: pronephros Figure 3 with image from Gessler et al., 2022
pronephros regeneration delayed, abnormal WT + MO1-ada2a + MO1-ada2b ablation: pronephros Figure 3 with image from Gessler et al., 2022
pronephros damaged, abnormal WT + MO1-ada2a + MO1-ada2b ablation: pronephros Figure 3 with image from Gessler et al., 2022
pronephros regeneration decreased rate, abnormal WT + MO1-ada2b + MO1-adora1b + MO1-p2ry2.1 + MO1-p2ry2.2 + MO1-p2ry2.3 ablation: pronephros Figure 5 with image from Gessler et al., 2022
pronephros regeneration decreased occurrence, abnormal WT + MO1-ada2b + MO1-adora1b + MO1-p2ry2.1 + MO1-p2ry2.2 + MO1-p2ry2.3 ablation: pronephros Figure 5 with image from Gessler et al., 2022
pronephros regeneration delayed, abnormal WT + MO1-ada2b + MO1-adora1b + MO1-p2ry2.1 + MO1-p2ry2.2 + MO1-p2ry2.3 ablation: pronephros Figure 5 with image from Gessler et al., 2022
pronephros damaged, abnormal WT + MO1-ada2b + MO1-adora1b + MO1-p2ry2.1 + MO1-p2ry2.2 + MO1-p2ry2.3 ablation: pronephros Figure 5 with image from Gessler et al., 2022
cranium hemorrhagic, abnormal ada2ala023164Tg + MO1-ada2b standard conditions text only from Zhou et al., 2014
Citations