Morpholino

MO1-cdc42

ID
ZDB-MRPHLNO-150120-1
Name
MO1-cdc42
Previous Names
None
Target
Sequence
5' - CAACGACGCACTTGATCGTCTGCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdc42
Expressed Gene Anatomy Figures
wt1a Fig. 2 from Choi et al., 2013
Phenotype
Phenotype resulting from MO1-cdc42
Phenotype Fish Figures
brain hydrocephalic, abnormal WT + MO1-cdc42 Fig. 1,  Fig. 2 from Choi et al., 2013
caudal fin curved, abnormal WT + MO1-cdc42 Fig. 1 from Choi et al., 2013
caudal fin decreased length, abnormal WT + MO1-cdc42 Fig. 1 from Choi et al., 2013
eye decreased size, abnormal WT + MO1-cdc42 Fig. 1 from Choi et al., 2015
Fig. 1,  Fig. 2 from Choi et al., 2013
melanosome transport delayed, abnormal WT + MO1-cdc42 Fig. 6 from Choi et al., 2015
pericardium edematous, abnormal WT + MO1-cdc42 Fig. 1 from Choi et al., 2013
photoreceptor cell photoreceptor inner segment absent, abnormal WT + MO1-cdc42 Fig. 4 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment absent, abnormal WT + MO1-cdc42 Fig. 4 from Choi et al., 2015
Fig. 2 from Choi et al., 2013
photoreceptor cell photoreceptor outer segment decreased amount, abnormal WT + MO1-cdc42 Fig. 4 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment decreased length, abnormal WT + MO1-cdc42 Fig. 4 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment morphology, abnormal WT + MO1-cdc42 Fig. 4 from Choi et al., 2015
pronephric duct cilium disorganized, abnormal WT + MO1-cdc42 Fig. 2 from Choi et al., 2013
renal glomerulus disorganized, abnormal WT + MO1-cdc42 Fig. 2 from Choi et al., 2013
renal glomerulus distended, abnormal WT + MO1-cdc42 Fig. 2 from Choi et al., 2013
renal tubule dilated, abnormal WT + MO1-cdc42 Fig. 2 from Choi et al., 2013
retina apoptotic, abnormal WT + MO1-cdc42 Fig. 3 from Choi et al., 2015
retina decreased size, abnormal WT + MO1-cdc42 Fig. 2 from Choi et al., 2015
retina apoptotic process increased occurrence, abnormal WT + MO1-cdc42 Fig. 3 from Choi et al., 2015
retina cell decreased amount, abnormal WT + MO1-cdc42 Fig. 2 from Choi et al., 2015
retinal ganglion cell layer apoptotic, abnormal WT + MO1-cdc42 Fig. 3 from Choi et al., 2015
retinal inner nuclear layer apoptotic, abnormal WT + MO1-cdc42 Fig. 3 from Choi et al., 2015
retinal outer nuclear layer decreased thickness, abnormal WT + MO1-cdc42 Fig. 2 from Choi et al., 2015
Phenotype of all Fish created by or utilizing MO1-cdc42
Phenotype Fish Conditions Figures
retinal ganglion cell layer apoptotic, abnormal WT + MO1-cdc42 standard conditions Fig. 3 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment decreased length, abnormal WT + MO1-cdc42 standard conditions Fig. 4 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment absent, abnormal WT + MO1-cdc42 standard conditions Fig. 4 from Choi et al., 2015
Fig. 2 from Choi et al., 2013
pronephric duct cilium disorganized, abnormal WT + MO1-cdc42 standard conditions Fig. 2 from Choi et al., 2013
renal glomerulus distended, abnormal WT + MO1-cdc42 standard conditions Fig. 2 from Choi et al., 2013
photoreceptor cell photoreceptor outer segment morphology, abnormal WT + MO1-cdc42 standard conditions Fig. 4 from Choi et al., 2015
pericardium edematous, abnormal WT + MO1-cdc42 standard conditions Fig. 1 from Choi et al., 2013
renal glomerulus disorganized, abnormal WT + MO1-cdc42 standard conditions Fig. 2 from Choi et al., 2013
photoreceptor cell photoreceptor inner segment absent, abnormal WT + MO1-cdc42 standard conditions Fig. 4 from Choi et al., 2015
retina cell decreased amount, abnormal WT + MO1-cdc42 standard conditions Fig. 2 from Choi et al., 2015
retina apoptotic, abnormal WT + MO1-cdc42 standard conditions Fig. 3 from Choi et al., 2015
retina decreased size, abnormal WT + MO1-cdc42 standard conditions Fig. 2 from Choi et al., 2015
caudal fin decreased length, abnormal WT + MO1-cdc42 standard conditions Fig. 1 from Choi et al., 2013
caudal fin curved, abnormal WT + MO1-cdc42 standard conditions Fig. 1 from Choi et al., 2013
melanosome transport delayed, abnormal WT + MO1-cdc42 standard conditions Fig. 6 from Choi et al., 2015
brain hydrocephalic, abnormal WT + MO1-cdc42 standard conditions Fig. 1,  Fig. 2 from Choi et al., 2013
retinal inner nuclear layer apoptotic, abnormal WT + MO1-cdc42 standard conditions Fig. 3 from Choi et al., 2015
photoreceptor cell photoreceptor outer segment decreased amount, abnormal WT + MO1-cdc42 standard conditions Fig. 4 from Choi et al., 2015
retina apoptotic process increased occurrence, abnormal WT + MO1-cdc42 standard conditions Fig. 3 from Choi et al., 2015
eye decreased size, abnormal WT + MO1-cdc42 standard conditions Fig. 1 from Choi et al., 2015
Fig. 1,  Fig. 2 from Choi et al., 2013
retinal outer nuclear layer decreased thickness, abnormal WT + MO1-cdc42 standard conditions Fig. 2 from Choi et al., 2015
renal tubule dilated, abnormal WT + MO1-cdc42 standard conditions Fig. 2 from Choi et al., 2013
gut edematous, abnormal WT + MO1-cdc42 + MO1-dnmbp standard conditions Fig. 6 from Baek et al., 2016
cilium assembly disrupted, abnormal WT + MO1-cdc42 + MO1-dnmbp standard conditions Fig. 6 from Baek et al., 2016
eye decreased size, abnormal WT + MO1-cdc42 + MO1-dnmbp standard conditions Fig. 6 from Baek et al., 2016
post-vent region curved ventral, abnormal WT + MO1-cdc42 + MO1-dnmbp standard conditions Fig. 6 from Baek et al., 2016
pronephric duct cilium disorganized, abnormal WT + MO1-cdc42 + MO1-dnmbp standard conditions Fig. 6 from Baek et al., 2016
caudal fin curved, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 3 from Choi et al., 2013
photoreceptor cell photoreceptor outer segment morphology, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 5 from Choi et al., 2015
eye decreased size, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 5 from Choi et al., 2015
Fig. 3 from Choi et al., 2013
pericardium edematous, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 3 from Choi et al., 2013
retinal outer nuclear layer absent, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 5 from Choi et al., 2015
retina apoptotic, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions text only from Choi et al., 2015
caudal fin decreased length, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 3 from Choi et al., 2013
brain hydrocephalic, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 3 from Choi et al., 2013
photoreceptor cell photoreceptor outer segment decreased amount, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 5 from Choi et al., 2015
melanosome transport delayed, abnormal WT + MO1-cdc42 + MO1-exoc5 standard conditions Fig. 6 from Choi et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.