Morpholino
MO1-cdc42
- ID
- ZDB-MRPHLNO-150120-1
- Name
- MO1-cdc42
- Previous Names
- None
- Target
- Sequence
-
5' - CAACGACGCACTTGATCGTCTGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdc42
No data available
Phenotype
Phenotype resulting from MO1-cdc42
1 - 5 of 22 Show all
Phenotype of all Fish created by or utilizing MO1-cdc42
1 - 5 of 37 Show all
Citations
- Block, J., Rashkova, C., Castanon, I., Zoghi, S., Platon, J., Ardy, R.C., Fujiwara, M., Chaves, B., Schoppmeyer, R., van der Made, C.I., Jimenez Heredia, R., Harms, F.L., Alavi, S., Alsina, L., Sanchez Moreno, P., Ávila Polo, R., Cabrera-Pérez, R., Kostel Bal, S., Pfajfer, L., Ransmayr, B., Mautner, A.K., Kondo, R., Tinnacher, A., Caldera, M., Schuster, M., Domínguez Conde, C., Platzer, R., Salzer, E., Boyer, T., Brunner, H.G., Nooitgedagt-Frons, J.E., Iglesias, E., Deyà-Martinez, A., Camacho-Lovillo, M., Menche, J., Bock, C., Huppa, J.B., Pickl, W.F., Distel, M., Yoder, J.A., Traver, D., Engelhardt, K.R., Linden, T., Kager, L., Hannich, J.T., Hoischen, A., Hambleton, S., Illsinger, S., Da Costa, L., Kutsche, K., Chavoshzadeh, Z., van Buul, J.D., Antón, J., Calzada-Hernández, J., Neth, O., Viaud, J., Nishikimi, A., Dupré, L., Boztug, K. (2023) Systemic Inflammation and Normocytic Anemia in DOCK11 Deficiency. The New England Journal of Medicine. 389(6):527-539
- Baek, J.I., Kwon, S.H., Zuo, X., Kwon, S.Y., Kim, S.H., Lipschutz, J.H. (2016) Dynamin Binding Protein (Tuba) deficiency inhibits ciliogenesis and nephrogenesis in vitro and in vivo. The Journal of biological chemistry. 291(16):8632-43
- Choi, S.Y., Baek, J.I., Zuo, X., Kim, S.H., Dunaief, J.L., Lipschutz, J.H. (2015) Cdc42 and sec10 Are Required for Normal Retinal Development in Zebrafish. Investigative ophthalmology & visual science. 56:3361-3370
- Choi, S.Y., Chacon-Heszele, M.F., Huang, L., McKenna, S., Wilson, F.P., Zuo, X., and Lipschutz, J.H. (2013) Cdc42 Deficiency Causes Ciliary Abnormalities and Cystic Kidneys. Journal of the American Society of Nephrology : JASN. 24(9):1435-50
1 - 4 of 4
Show