Morpholino

MO1-myo5b

ID
ZDB-MRPHLNO-141231-1
Name
MO1-myo5b
Previous Names
None
Target
Sequence
5' - GATCTTCTATTACTGACCGAGTTGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-myo5b
No data available
Phenotype
Phenotype resulting from MO1-myo5b
Phenotype Fish Figures
cell endosome increased accumulation periderm, abnormal zf106Tg + MO1-myo5b Fig. 2 with image from Sonal et al., 2014
cell lysosome increased accumulation periderm, abnormal zf106Tg + MO1-myo5b Fig. 2 with image from Sonal et al., 2014
cell vesicle increased accumulation periderm, abnormal zf106Tg + MO1-myo5b Fig. 2 with image from Sonal et al., 2014
epidermal basal stratum cell population proliferation increased occurrence, abnormal WT + MO1-myo5b Fig. 5 with image from Sonal et al., 2014
epidermal cell ab2-cdh1 labeling increased amount, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 7 with image from Phatak et al., 2021
epidermal cell ab1-llgl2 labeling increased amount, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 6 with image from Phatak et al., 2021
epidermal cell cdh1 expression increased amount, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 7 with image from Phatak et al., 2021
epidermal cell increased thickness, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 6 with image from Phatak et al., 2021
epidermal cell irregular spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 6 with image from Phatak et al., 2021
epidermal cell ab2-cdh1 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 7 with image from Phatak et al., 2021
epidermal cell cdh1 expression spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 7 with image from Phatak et al., 2021
epidermal cell ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 6 with image from Phatak et al., 2021
epidermal cell delamination cellular spatiotemporal quality, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 7 with image from Phatak et al., 2021
epidermal cell delamination increased frequency, abnormal TU + MO1-myo5b Fig 4 with image,  Fig 5 with image from Phatak et al., 2021
epidermal cell membrane ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 6 with image from Phatak et al., 2021
epidermis dsc2l expression increased amount, abnormal TU + MO1-myo5b Fig 3 with image from Phatak et al., 2021
epidermis cldne expression increased amount, abnormal TU + MO1-myo5b Fig 3 with image from Phatak et al., 2021
epidermis oclna expression increased amount, abnormal TU + MO1-myo5b Fig 3 with image from Phatak et al., 2021
epidermis cldn7b expression increased amount, abnormal TU + MO1-myo5b Fig 3 with image from Phatak et al., 2021
epidermis cdh1 expression increased amount, abnormal TU + MO1-myo5b Fig 3 with image from Phatak et al., 2021
epidermis grhl3 expression increased amount, abnormal TU + MO1-myo5b Fig 3 with image from Phatak et al., 2021
periderm cell population proliferation increased occurrence, abnormal WT + MO1-myo5b Fig. 5 with image from Sonal et al., 2014
peridermal cell decreased size, abnormal zf106Tg + MO1-myo5b Fig. 4 with image,  Fig. 5 with image from Sonal et al., 2014
peridermal cell increased amount, abnormal WT + MO1-myo5b Fig. 5 with image from Sonal et al., 2014
peridermal cell apical plasma membrane decreased area, abnormal zf106Tg + MO1-myo5b Fig. 4 with image from Sonal et al., 2014
peridermal cell basolateral plasma membrane decreased area, abnormal zf106Tg + MO1-myo5b Fig. 4 with image from Sonal et al., 2014
peridermal cell cell projection membrane absent, abnormal zf106Tg + MO1-myo5b Fig. 4 with image from Sonal et al., 2014
peridermal cell delamination increased frequency, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 1 with image from Phatak et al., 2021
peridermal cell epithelial structure maintenance decreased process quality, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 1 with image from Phatak et al., 2021
peridermal cell organelle membrane EGFP expression spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 1 with image,  Fig 4 with image from Phatak et al., 2021
peridermal cell plasma membrane EGFP expression spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 1 with image,  Fig 4 with image from Phatak et al., 2021
peridermal cell regulation of cell adhesion process quality, abnormal zf106Tg/zf106Tg + MO1-myo5b Fig 1 with image from Phatak et al., 2021
Phenotype of all Fish created by or utilizing MO1-myo5b
Phenotype Fish Conditions Figures
epidermal cell membrane ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell irregular spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell cdh1 expression increased amount, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell cdh1 expression spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 7 with image from Phatak et al., 2021
peridermal cell organelle membrane EGFP expression spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 1 with image,  Fig 4 with image from Phatak et al., 2021
epidermal cell ab2-cdh1 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 7 with image from Phatak et al., 2021
peridermal cell regulation of cell adhesion process quality, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 1 with image from Phatak et al., 2021
epidermal cell ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 6 with image from Phatak et al., 2021
peridermal cell delamination increased frequency, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 1 with image from Phatak et al., 2021
epidermal cell ab1-llgl2 labeling increased amount, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell delamination cellular spatiotemporal quality, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell ab2-cdh1 labeling increased amount, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 7 with image from Phatak et al., 2021
peridermal cell epithelial structure maintenance decreased process quality, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 1 with image from Phatak et al., 2021
epidermal cell increased thickness, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 6 with image from Phatak et al., 2021
peridermal cell plasma membrane EGFP expression spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b standard conditions Fig 1 with image,  Fig 4 with image from Phatak et al., 2021
epidermis cdh1 expression increased amount, abnormal TU + MO1-myo5b standard conditions Fig 3 with image from Phatak et al., 2021
epidermal cell delamination increased frequency, abnormal TU + MO1-myo5b standard conditions Fig 4 with image,  Fig 5 with image from Phatak et al., 2021
epidermis cldne expression increased amount, abnormal TU + MO1-myo5b standard conditions Fig 3 with image from Phatak et al., 2021
epidermis cldn7b expression increased amount, abnormal TU + MO1-myo5b standard conditions Fig 3 with image from Phatak et al., 2021
epidermis grhl3 expression increased amount, abnormal TU + MO1-myo5b standard conditions Fig 3 with image from Phatak et al., 2021
epidermis dsc2l expression increased amount, abnormal TU + MO1-myo5b standard conditions Fig 3 with image from Phatak et al., 2021
epidermis oclna expression increased amount, abnormal TU + MO1-myo5b standard conditions Fig 3 with image from Phatak et al., 2021
periderm cell population proliferation increased occurrence, abnormal WT + MO1-myo5b standard conditions Fig. 5 with image from Sonal et al., 2014
epidermal basal stratum cell population proliferation increased occurrence, abnormal WT + MO1-myo5b standard conditions Fig. 5 with image from Sonal et al., 2014
peridermal cell increased amount, abnormal WT + MO1-myo5b standard conditions Fig. 5 with image from Sonal et al., 2014
cell lysosome increased accumulation periderm, abnormal zf106Tg + MO1-myo5b standard conditions Fig. 2 with image from Sonal et al., 2014
peridermal cell apical plasma membrane decreased area, abnormal zf106Tg + MO1-myo5b standard conditions Fig. 4 with image from Sonal et al., 2014
peridermal cell decreased size, abnormal zf106Tg + MO1-myo5b standard conditions Fig. 4 with image,  Fig. 5 with image from Sonal et al., 2014
cell vesicle increased accumulation periderm, abnormal zf106Tg + MO1-myo5b standard conditions Fig. 2 with image from Sonal et al., 2014
peridermal cell cell projection membrane absent, abnormal zf106Tg + MO1-myo5b standard conditions Fig. 4 with image from Sonal et al., 2014
cell endosome increased accumulation periderm, abnormal zf106Tg + MO1-myo5b standard conditions Fig. 2 with image from Sonal et al., 2014
peridermal cell basolateral plasma membrane decreased area, abnormal zf106Tg + MO1-myo5b standard conditions Fig. 4 with image from Sonal et al., 2014
epidermal cell delamination normal frequency, ameliorated grhl3zf3707/zf3707 + MO1-myo5b standard conditions Fig 4 with image from Phatak et al., 2021
epidermal cell delamination cellular spatiotemporal quality, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
peridermal cell organelle membrane EGFP expression spatial pattern, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 4 with image from Phatak et al., 2021
epidermal cell membrane ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell decreased thickness, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell ab2-cdh1 labeling spatial pattern, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell ab1-llgl2 labeling increased amount, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell cell division increased frequency, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
peridermal cell plasma membrane EGFP expression spatial pattern, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 4 with image from Phatak et al., 2021
epidermal cell irregular spatial pattern, exacerbated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell ab2-cdh1 labeling amount, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell cdh1 expression amount, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell cdh1 expression spatial pattern, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell delamination normal frequency, ameliorated TU + MO1-myo5b + MO4-grhl3 standard conditions Fig 4 with image from Phatak et al., 2021
epidermal cell delamination increased frequency, exacerbated TU + MO1-myo5b + MO4-grhl3 standard conditions Fig 5 with image from Phatak et al., 2021
periderm cell decreased amount, abnormal WT + MO1-myo5b + MO2-tp63 standard conditions Fig. 5 with image from Sonal et al., 2014
peridermal cell apoptotic process increased occurrence, abnormal WT + MO1-myo5b + MO2-tp63 standard conditions Fig. 5 with image from Sonal et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.