Morpholino

MO1-dre-mir-132-1

ID
ZDB-MRPHLNO-141121-2
Name
MO1-dre-mir-132-1
Previous Names
  • MO1-mir132-1
Target
Sequence
5' - AGCGACCATGGCTGTAGACTGTTAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dre-mir-132-1
No data available
Phenotype
Phenotype resulting from MO1-dre-mir-132-1
Phenotype of all Fish created by or utilizing MO1-dre-mir-132-1
Phenotype Fish Conditions Figures
whole organism cdh5 expression decreased amount, abnormal AB + MO1-dre-mir-132-1 standard conditions Fig. 2 with image from Xu et al., 2017
cranial vasculature hemorrhagic, abnormal AB + MO1-dre-mir-132-1 standard conditions Fig. 1 with imageFig. 6 from Xu et al., 2017
whole organism plvapb expression decreased amount, abnormal AB + MO1-dre-mir-132-1 standard conditions Fig. 2 with image from Xu et al., 2017
whole organism eef2k expression decreased amount, abnormal AB + MO1-dre-mir-132-1 standard conditions Fig. 6 from Xu et al., 2017
blood cell increased accumulation ventricular system, abnormal AB + MO1-dre-mir-132-1 standard conditions Fig. S1 from Xu et al., 2017
central canal malformed, abnormal WT + MO1-dre-mir-132-1 standard conditions Fig. 1 with image from Salta et al., 2014
trunk glial cell projection mislocalised, abnormal WT + MO1-dre-mir-132-1 standard conditions Fig. 1 with imageFig. 3 with image from Salta et al., 2014
trunk glial cell projection mislocalised, abnormal mi2001Tg + MO1-dre-mir-132-1 standard conditions Fig. 5 with image from Salta et al., 2014
brain blood vessel broken, abnormal s843Tg + MO1-dre-mir-132-1 standard conditions Fig. S1 from Xu et al., 2017
cranial vasculature hemorrhagic, abnormal s843Tg + MO1-dre-mir-132-1 standard conditions Fig. S1 from Xu et al., 2017
brain vasculature cdh5 expression decreased amount, abnormal s843Tg + MO1-dre-mir-132-1 standard conditions Fig. 2 with image from Xu et al., 2017
brain blood vasculature decreased amount, abnormal s843Tg + MO1-dre-mir-132-1 standard conditions Fig. S2 from Xu et al., 2017
brain blood vessel endothelial cell separated from blood vessel endothelial cell, abnormal s843Tg + MO1-dre-mir-132-1 standard conditions Fig. S1 from Xu et al., 2017
cranial vasculature hemorrhagic, abnormal s843Tg; sd2Tg + MO1-dre-mir-132-1 standard conditions Fig. 1 with image from Xu et al., 2017
blood vessel cell-cell junction decreased amount, abnormal s843Tg; sd2Tg + MO1-dre-mir-132-1 standard conditions Fig. 1 with image from Xu et al., 2017
cranial vasculature structure, ameliorated AB + MO1-dre-mir-132-1 + MO1-eef2k standard conditions Fig. 6 from Xu et al., 2017
Citations