Morpholino
MO1-ambra1a
- ID
- ZDB-MRPHLNO-140918-5
- Name
- MO1-ambra1a
- Previous Names
- None
- Target
- Sequence
-
5' - CTCCAAACACTCTTCCTCACTCCCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ambra1a
No data available
Phenotype
Phenotype resulting from MO1-ambra1a
1 - 5 of 59 Show all
Phenotype of all Fish created by or utilizing MO1-ambra1a
1 - 5 of 118 Show all
Citations
- Fontana, C.M., Terrin, F., Facchinello, N., Meneghetti, G., Dinarello, A., Gambarotto, L., Zuccarotto, A., Caichiolo, M., Brocca, G., Verin, R., Nazio, F., Carnevali, O., Cecconi, F., Bonaldo, P., Dalla Valle, L. (2023) Zebrafish ambra1b knockout reveals a novel role for Ambra1 in primordial germ cells survival, sex differentiation and reproduction. Biological research. 56:1919
- Meneghetti, G., Skobo, T., Chrisam, M., Fontana, C.M., Facchinello, N., Nazio, F., Cecconi, F., Bonaldo, P., Dalla Valle, L. (2020) Zebrafish ambra1a and ambra1b Silencing Affect Heart Development. Zebrafish. :
- Ye, J., Tong, Y., Lv, J., Peng, R., Chen, S., Kuang, L., Su, K., Zheng, Y., Zhang, T., Zhang, F., Jin, L., Yang, X., Wang, H. (2020) Rare mutations in the autophagy-regulating gene AMBRA1 contribute to human neural tube defects. Human Mutation. 41(8):1383-1393
- Cianfanelli, V., Fuoco, C., Lorente, M., Salazar, M., Quondamatteo, F., Gherardini, P.F., De Zio, D., Nazio, F., Antonioli, M., D'Orazio, M., Skobo, T., Bordi, M., Rohde, M., Dalla Valle, L., Helmer-Citterich, M., Gretzmeier, C., Dengjel, J., Fimia, G.M., Piacentini, M., Di Bartolomeo, S., Velasco, G., Cecconi, F. (2015) AMBRA1 links autophagy to cell proliferation and tumorigenesis by promoting c-Myc dephosphorylation and degradation. Nature cell biology. 17:20-30
- Skobo, T., Benato, F., Grumati, P., Meneghetti, G., Cianfanelli, V., Castagnaro, S., Chrisam, M., Di Bartolomeo, S., Bonaldo, P., Cecconi, F., Valle, L.D. (2014) Zebrafish ambra1a and ambra1b Knockdown Impairs Skeletal Muscle Development. PLoS One. 9:e99210
- Benato, F., Skobo, T., Gioacchini, G., Moro, I., Ciccosanti, F., Piacentini, M., Fimia, G.M., Carnevali, O., and Dalla Valle, L. (2013) Ambra1 knockdown in zebrafish leads to incomplete development due to severe defects in organogenesis. Autophagy. 9(4):476-495
1 - 6 of 6
Show