Morpholino

MO1-ambra1a

ID
ZDB-MRPHLNO-140918-5
Name
MO1-ambra1a
Previous Names
None
Target
Sequence
5' - CTCCAAACACTCTTCCTCACTCCCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ambra1a
No data available
Phenotype
Phenotype resulting from MO1-ambra1a
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO1-ambra1a Fig. 12 from Benato et al., 2013
autophagy decreased process quality, abnormal WT + MO1-ambra1a Fig. 11 from Benato et al., 2013
autophagy disrupted, abnormal AB + MO1-ambra1a Fig. 4 from Ye et al., 2020
cell population proliferation increased occurrence, abnormal AB + MO1-ambra1a Fig. 4 with image from Meneghetti et al., 2020
Fig. 5 with image from Skobo et al., 2014
embryo development disrupted, abnormal WT + MO1-ambra1a + MO4-tp53 Fig. 1 with image from Skobo et al., 2014
Fig. 6 from Benato et al., 2013
embryonic heart tube development disrupted, abnormal WT + MO1-ambra1a Fig. 1 with imageFig. 2 with imageFig. 3 with image from Meneghetti et al., 2020
embryonic heart tube left/right pattern formation disrupted, abnormal WT + MO1-ambra1a Fig. 2 with imageFig. 3 with image from Meneghetti et al., 2020
eye decreased size, abnormal WT + MO1-ambra1a Fig. 6Fig. 7Fig. 8 from Benato et al., 2013
fourth ventricle hydrocephalic, abnormal WT + MO1-ambra1a Fig. 7 from Benato et al., 2013
hatching disrupted, abnormal AB + MO1-ambra1a Fig. S3 with image from Skobo et al., 2014
head apoptotic, abnormal WT + MO1-ambra1a Fig. 12 from Benato et al., 2013
head decreased size, abnormal WT + MO1-ambra1a + MO4-tp53 Fig. 6 from Benato et al., 2013
head morphology, abnormal AB + MO1-ambra1a Fig. 3 from Ye et al., 2020
heart edematous, abnormal WT + MO1-ambra1a Fig. 1 with image from Meneghetti et al., 2020
heart looping disrupted, abnormal ambra1aia35 + MO1-ambra1a Fig. 2 with imageFig. 3 with image from Meneghetti et al., 2020
heart tube malformed, abnormal WT + MO1-ambra1a Fig. 1 with imageFig. 2 with image from Meneghetti et al., 2020
intersegmental vessel morphology, abnormal WT + MO1-ambra1a Fig. S3 from Benato et al., 2013
muscle disorganized, abnormal AB + MO1-ambra1a Fig. 7 with image from Skobo et al., 2014
muscle mitochondrion morphology, abnormal AB + MO1-ambra1a Fig. 8 with image from Skobo et al., 2014
muscle sarcomere decreased amount, abnormal AB + MO1-ambra1a Fig. 7 with image from Skobo et al., 2014
muscle sarcomere disorganized, abnormal AB + MO1-ambra1a Fig. 7 with image from Skobo et al., 2014
muscle sarcoplasmic reticulum dilated, abnormal AB + MO1-ambra1a Fig. 8 with image from Skobo et al., 2014
muscle striated muscle thin filament separated from muscle myosin filament, abnormal AB + MO1-ambra1a Fig. 8 with image from Skobo et al., 2014
muscle cell degenerate, abnormal AB + MO1-ambra1a Fig. 7 with image from Skobo et al., 2014
muscle cell disorganized, abnormal AB + MO1-ambra1a Fig. 3 with imageFig. 8 with imageFig. 9 with image from Skobo et al., 2014
muscle cell nucleus increased amount, abnormal AB + MO1-ambra1a Fig. 3 with image from Skobo et al., 2014
muscle cell nucleus morphology, abnormal AB + MO1-ambra1a Fig. 4 with imageFig. 8 with image from Skobo et al., 2014
myoseptum morphology, abnormal AB + MO1-ambra1a Fig. 3 with imageFig. 9 with image from Skobo et al., 2014
myoseptum unstructured, abnormal AB + MO1-ambra1a Fig. 4 with image from Skobo et al., 2014
myosin filament organization disrupted, abnormal AB + MO1-ambra1a Fig. 9 with image from Skobo et al., 2014
notochord disorganized, abnormal WT + MO1-ambra1a Fig. 7 from Benato et al., 2013
notochord undulate, abnormal AB + MO1-ambra1a Fig. 2 with image from Skobo et al., 2014
otic vesicle decreased size, abnormal WT + MO1-ambra1a Fig. 8 from Benato et al., 2013
otolith decreased size, abnormal WT + MO1-ambra1a Fig. 6 from Benato et al., 2013
pericardial cavity hemorrhagic, abnormal AB + MO1-ambra1a Fig. 3 from Ye et al., 2020
pericardial cavity increased size, abnormal AB + MO1-ambra1a Fig. 3 from Ye et al., 2020
pericardium edematous, abnormal WT + MO1-ambra1a Fig. 8 from Benato et al., 2013
pigmentation delayed, abnormal WT + MO1-ambra1a + MO4-tp53 Fig. 6 from Benato et al., 2013
post-vent region curved, abnormal AB + MO1-ambra1a Fig. 1 with image from Skobo et al., 2014
post-vent region deformed, abnormal WT + MO1-ambra1a Fig. 7 from Benato et al., 2013
post-vent region kinked, abnormal WT + MO1-ambra1a + MO4-tp53 Fig. 6 from Benato et al., 2013
Rohon-Beard neuron mislocalised, abnormal WT + MO1-ambra1a Fig. 2 with image from Meneghetti et al., 2020
skeletal myofibril assembly disrupted, abnormal AB + MO1-ambra1a Fig. 9 with image from Skobo et al., 2014
somite morphology, abnormal AB + MO1-ambra1a Fig. 2 with image from Skobo et al., 2014
somite shape, abnormal AB + MO1-ambra1a Fig. 9 with image from Skobo et al., 2014
subintestinal vein morphology, abnormal WT + MO1-ambra1a Fig. S3 from Benato et al., 2013
swimming process quality, abnormal AB + MO1-ambra1a Fig. S4 with image from Skobo et al., 2014
tectal ventricle hydrocephalic, abnormal WT + MO1-ambra1a Fig. 7 from Benato et al., 2013
thigmotaxis disrupted, abnormal AB + MO1-ambra1a Fig. S4 with image from Skobo et al., 2014
trunk curved, abnormal AB + MO1-ambra1a Fig. 3 from Ye et al., 2020
trunk decreased size, abnormal WT + MO1-ambra1a Fig. 6 from Benato et al., 2013
trunk musculature muscle cell disorganized, abnormal AB + MO1-ambra1a Fig. 4 with image from Skobo et al., 2014
whole organism dead, abnormal WT + MO1-ambra1a text only from Benato et al., 2013
whole organism decreased size, abnormal AB + MO1-ambra1a Fig. 1 with image from Skobo et al., 2014
whole organism deformed, abnormal WT + MO1-ambra1a + MO4-tp53 Fig. 6 from Benato et al., 2013
whole organism refractivity, abnormal AB + MO1-ambra1a Fig. 1 with image from Skobo et al., 2014
whole organism anterior-posterior axis decreased length, abnormal AB + MO1-ambra1a Fig. 3 from Ye et al., 2020
whole organism anterior-posterior axis shortened, abnormal AB + MO1-ambra1a Fig. 2 with image from Skobo et al., 2014
yolk syncytial layer edematous, abnormal WT + MO1-ambra1a Fig. 8 from Benato et al., 2013
Phenotype of all Fish created by or utilizing MO1-ambra1a
Phenotype Fish Conditions Figures
autophagy process quality, ameliorated AB + MO1-ambra1a chemical treatment by injection: trehalose Fig. 4 from Ye et al., 2020
muscle mitochondrion morphology, abnormal AB + MO1-ambra1a standard conditions Fig. 8 with image from Skobo et al., 2014
trunk musculature muscle cell disorganized, abnormal AB + MO1-ambra1a standard conditions Fig. 4 with image from Skobo et al., 2014
thigmotaxis disrupted, abnormal AB + MO1-ambra1a standard conditions Fig. S4 with image from Skobo et al., 2014
head morphology, abnormal AB + MO1-ambra1a standard conditions Fig. 3 from Ye et al., 2020
whole organism refractivity, abnormal AB + MO1-ambra1a standard conditions Fig. 1 with image from Skobo et al., 2014
muscle cell nucleus morphology, abnormal AB + MO1-ambra1a standard conditions Fig. 4 with imageFig. 8 with image from Skobo et al., 2014
myoseptum unstructured, abnormal AB + MO1-ambra1a standard conditions Fig. 4 with image from Skobo et al., 2014
somite morphology, abnormal AB + MO1-ambra1a standard conditions Fig. 2 with image from Skobo et al., 2014
muscle sarcomere disorganized, abnormal AB + MO1-ambra1a standard conditions Fig. 7 with image from Skobo et al., 2014
somite shape, abnormal AB + MO1-ambra1a standard conditions Fig. 9 with image from Skobo et al., 2014
trunk curved, abnormal AB + MO1-ambra1a standard conditions Fig. 3 from Ye et al., 2020
pericardial cavity increased size, abnormal AB + MO1-ambra1a standard conditions Fig. 3 from Ye et al., 2020
muscle disorganized, abnormal AB + MO1-ambra1a standard conditions Fig. 7 with image from Skobo et al., 2014
myoseptum morphology, abnormal AB + MO1-ambra1a standard conditions Fig. 3 with imageFig. 9 with image from Skobo et al., 2014
swimming process quality, abnormal AB + MO1-ambra1a standard conditions Fig. S4 with image from Skobo et al., 2014
whole organism anterior-posterior axis decreased length, abnormal AB + MO1-ambra1a standard conditions Fig. 3 from Ye et al., 2020
muscle striated muscle thin filament separated from muscle myosin filament, abnormal AB + MO1-ambra1a standard conditions Fig. 8 with image from Skobo et al., 2014
cell population proliferation increased occurrence, abnormal AB + MO1-ambra1a standard conditions Fig. 5 with image from Skobo et al., 2014
autophagy disrupted, abnormal AB + MO1-ambra1a standard conditions Fig. 4 from Ye et al., 2020
myosin filament organization disrupted, abnormal AB + MO1-ambra1a standard conditions Fig. 9 with image from Skobo et al., 2014
pericardial cavity hemorrhagic, abnormal AB + MO1-ambra1a standard conditions Fig. 3 from Ye et al., 2020
hatching disrupted, abnormal AB + MO1-ambra1a standard conditions Fig. S3 with image from Skobo et al., 2014
whole organism decreased size, abnormal AB + MO1-ambra1a standard conditions Fig. 1 with image from Skobo et al., 2014
skeletal myofibril assembly disrupted, abnormal AB + MO1-ambra1a standard conditions Fig. 9 with image from Skobo et al., 2014
muscle cell disorganized, abnormal AB + MO1-ambra1a standard conditions Fig. 3 with imageFig. 8 with imageFig. 9 with image from Skobo et al., 2014
muscle cell nucleus increased amount, abnormal AB + MO1-ambra1a standard conditions Fig. 3 with image from Skobo et al., 2014
muscle sarcoplasmic reticulum dilated, abnormal AB + MO1-ambra1a standard conditions Fig. 8 with image from Skobo et al., 2014
post-vent region curved, abnormal AB + MO1-ambra1a standard conditions Fig. 1 with image from Skobo et al., 2014
whole organism anterior-posterior axis shortened, abnormal AB + MO1-ambra1a standard conditions Fig. 2 with image from Skobo et al., 2014
muscle sarcomere decreased amount, abnormal AB + MO1-ambra1a standard conditions Fig. 7 with image from Skobo et al., 2014
embryo development disrupted, abnormal AB + MO1-ambra1a standard conditions Fig. 1 with image from Skobo et al., 2014
muscle cell degenerate, abnormal AB + MO1-ambra1a standard conditions Fig. 7 with image from Skobo et al., 2014
notochord undulate, abnormal AB + MO1-ambra1a standard conditions Fig. 2 with image from Skobo et al., 2014
heart edematous, abnormal WT + MO1-ambra1a standard conditions Fig. 1 with image from Meneghetti et al., 2020
heart tube malformed, abnormal WT + MO1-ambra1a standard conditions Fig. 1 with imageFig. 2 with image from Meneghetti et al., 2020
head decreased size, abnormal WT + MO1-ambra1a standard conditions Fig. 6 from Benato et al., 2013
notochord disorganized, abnormal WT + MO1-ambra1a standard conditions Fig. 7 from Benato et al., 2013
embryonic heart tube left/right pattern formation disrupted, abnormal WT + MO1-ambra1a standard conditions Fig. 2 with image from Meneghetti et al., 2020
head apoptotic, abnormal WT + MO1-ambra1a standard conditions Fig. 12 from Benato et al., 2013
cell population proliferation increased occurrence, abnormal WT + MO1-ambra1a standard conditions Fig. 4 with image from Meneghetti et al., 2020
apoptotic process increased occurrence, abnormal WT + MO1-ambra1a standard conditions Fig. 12 from Benato et al., 2013
post-vent region deformed, abnormal WT + MO1-ambra1a standard conditions Fig. 7 from Benato et al., 2013
whole organism deformed, abnormal WT + MO1-ambra1a standard conditions Fig. 6 from Benato et al., 2013
post-vent region kinked, abnormal WT + MO1-ambra1a standard conditions Fig. 6 from Benato et al., 2013
trunk decreased size, abnormal WT + MO1-ambra1a standard conditions Fig. 6 from Benato et al., 2013
Rohon-Beard neuron mislocalised, abnormal WT + MO1-ambra1a standard conditions Fig. 2 with image from Meneghetti et al., 2020
heart looping disrupted, abnormal WT + MO1-ambra1a standard conditions Fig. 2 with image from Meneghetti et al., 2020
tectal ventricle hydrocephalic, abnormal WT + MO1-ambra1a standard conditions Fig. 7 from Benato et al., 2013
autophagy decreased process quality, abnormal WT + MO1-ambra1a standard conditions Fig. 11 from Benato et al., 2013
eye decreased size, abnormal WT + MO1-ambra1a standard conditions Fig. 6Fig. 7Fig. 8 from Benato et al., 2013
pigmentation delayed, abnormal WT + MO1-ambra1a standard conditions Fig. 6 from Benato et al., 2013
embryo development disrupted, abnormal WT + MO1-ambra1a standard conditions Fig. 6 from Benato et al., 2013
yolk syncytial layer edematous, abnormal WT + MO1-ambra1a standard conditions Fig. 8 from Benato et al., 2013
otolith decreased size, abnormal WT + MO1-ambra1a standard conditions Fig. 6 from Benato et al., 2013
embryonic heart tube development disrupted, abnormal WT + MO1-ambra1a standard conditions Fig. 1 with imageFig. 2 with image from Meneghetti et al., 2020
fourth ventricle hydrocephalic, abnormal WT + MO1-ambra1a standard conditions Fig. 7 from Benato et al., 2013
pericardium edematous, abnormal WT + MO1-ambra1a standard conditions Fig. 8 from Benato et al., 2013
subintestinal vein morphology, abnormal WT + MO1-ambra1a standard conditions Fig. S3 from Benato et al., 2013
otic vesicle decreased size, abnormal WT + MO1-ambra1a standard conditions Fig. 8 from Benato et al., 2013
whole organism dead, abnormal WT + MO1-ambra1a standard conditions text only from Benato et al., 2013
intersegmental vessel morphology, abnormal WT + MO1-ambra1a standard conditions Fig. S3 from Benato et al., 2013
eye decreased size, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
pigmentation delayed, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
head decreased size, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
trunk decreased size, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
post-vent region kinked, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
whole organism deformed, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
otolith decreased size, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
embryo development disrupted, abnormal WT + MO1-ambra1a + MO4-tp53 standard conditions Fig. 6 from Benato et al., 2013
embryonic heart tube development disrupted, abnormal ambra1aia35 + MO1-ambra1a standard conditions Fig. 3 with image from Meneghetti et al., 2020
embryonic heart tube left/right pattern formation disrupted, abnormal ambra1aia35 + MO1-ambra1a standard conditions Fig. 3 with image from Meneghetti et al., 2020
heart looping disrupted, abnormal ambra1aia35 + MO1-ambra1a standard conditions Fig. 3 with image from Meneghetti et al., 2020
muscle cell degenerate, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 7 with image from Skobo et al., 2014
muscle sarcomere decreased amount, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 7 with image from Skobo et al., 2014
muscle sarcomere disorganized, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 7 with image from Skobo et al., 2014
trunk musculature muscle cell disorganized, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 4 with image from Skobo et al., 2014
myoseptum unstructured, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 4 with image from Skobo et al., 2014
muscle cell nucleus morphology, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 4 with imageFig. 8 with image from Skobo et al., 2014
muscle cell disorganized, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 3 with imageFig. 8 with imageFig. 9 with image from Skobo et al., 2014
somite morphology, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 2 with image from Skobo et al., 2014
skeletal myofibril assembly disrupted, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 9 with image from Skobo et al., 2014
hatching disrupted, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. S3 with image from Skobo et al., 2014
muscle striated muscle thin filament separated from muscle myosin filament, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 8 with image from Skobo et al., 2014
swimming process quality, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. S4 with image from Skobo et al., 2014
muscle mitochondrion morphology, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 8 with image from Skobo et al., 2014
thigmotaxis disrupted, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. S4 with image from Skobo et al., 2014
muscle disorganized, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 7 with image from Skobo et al., 2014
cell population proliferation increased occurrence, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 5 with image from Skobo et al., 2014
somite shape, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 9 with image from Skobo et al., 2014
myoseptum morphology, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 3 with imageFig. 9 with image from Skobo et al., 2014
notochord undulate, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 2 with image from Skobo et al., 2014
myosin filament organization disrupted, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 9 with image from Skobo et al., 2014
whole organism anterior-posterior axis shortened, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 2 with image from Skobo et al., 2014
muscle cell nucleus increased amount, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 3 with image from Skobo et al., 2014
muscle sarcoplasmic reticulum dilated, abnormal AB + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 8 with image from Skobo et al., 2014
heart tube malformed, exacerbated WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 1 with image from Meneghetti et al., 2020
head decreased size, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 6 from Benato et al., 2013
eye decreased size, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 6Fig. 7Fig. 8 from Benato et al., 2013
fourth ventricle hydrocephalic, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 7 from Benato et al., 2013
whole organism deformed, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 6 from Benato et al., 2013
whole organism decreased size, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 1 with image from Skobo et al., 2014
otic vesicle decreased size, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 8 from Benato et al., 2013
embryo development disrupted, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 1 with image from Skobo et al., 2014
Fig. 6 from Benato et al., 2013
otolith decreased size, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 6 from Benato et al., 2013
embryonic heart tube development disrupted, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 1 with image from Meneghetti et al., 2020
heart edematous, exacerbated WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 1 with image from Meneghetti et al., 2020
notochord disorganized, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 7 from Benato et al., 2013
whole organism refractivity, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 1 with image from Skobo et al., 2014
head apoptotic, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 12 from Benato et al., 2013
post-vent region curved, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 1 with image from Skobo et al., 2014
apoptotic process increased occurrence, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 12 from Benato et al., 2013
intersegmental vessel morphology, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. S3 from Benato et al., 2013
eye adjacent to eye, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 8 from Benato et al., 2013
tectal ventricle hydrocephalic, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 7 from Benato et al., 2013
subintestinal vein morphology, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. S3 from Benato et al., 2013
post-vent region kinked, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 6 from Benato et al., 2013
post-vent region deformed, abnormal WT + MO1-ambra1a + MO1-ambra1b standard conditions Fig. 7 from Benato et al., 2013
Citations