Morpholino
MO1-sema6a
- ID
- ZDB-MRPHLNO-140821-3
- Name
- MO1-sema6a
- Previous Names
- None
- Target
- Sequence
-
5' - TGCTGATATCCTGCACTCACCTCAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sema6a
No data available
Phenotype
Phenotype resulting from MO1-sema6a
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO1-sema6a
1 - 5 of 13 Show all
Citations
- Bowley, G., Irving, S., Hoefer, I., Wilkinson, R., Pasterkamp, G., Darwish, H.M.S., White, S., Francis, S.E., Chico, T., Noel, E., Serbanovic-Canic, J., Evans, P.C. (2024) Zebrafish model for functional screening of flow-responsive genes controlling endothelial cell proliferation. Scientific Reports. 14:3013030130
- Emerson, S.E., St Clair, R.M., Waldron, A.L., Bruno, S.R., Duong, A., Driscoll, H.E., Ballif, B.A., McFarlane, S., Ebert, A.M. (2017) Identification of target genes downstream of Semaphorin6A/PlexinA2 signaling in zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 246(7):539-549
- Ebert, A.M., Childs, S.J., Hehr, C.L., Cechmanek, P.B., McFarlane, S. (2014) Sema6a and Plxna2 mediate spatially regulated repulsion within the developing eye to promote eye vesicle cohesion. Development (Cambridge, England). 141:2473-82
1 - 3 of 3
Show