Morpholino
MO1-dnajb6b
- ID
- ZDB-MRPHLNO-140722-5
- Name
- MO1-dnajb6b
- Previous Names
- None
- Target
- Sequence
-
5' - AAATATCCAATACCATCTGACAGGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dnajb6b
No data available
Phenotype
Phenotype resulting from MO1-dnajb6b
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO1-dnajb6b
1 - 5 of 12 Show all
Citations
- Bührdel, J.B., Hirth, S., Keßler, M., Westphal, S., Forster, M., Manta, L., Wiche, G., Schoser, B., Schessl, J., Schröder, R., Clemen, C.S., Eichinger, L., Fürst, D.O., van der Ven, P.F., Rottbauer, W., Just, S. (2015) In vivo characterization of human myofibrillar myopathy genes in zebrafish. Biochemical and Biophysical Research Communications. 461(2):217-23
- Sarparanta, J., Jonson, P.H., Golzio, C., Sandell S, Luque, H., Screen, M., McDonald, K., Stajich, J.M., Mahjneh, I., Vihola, A., Raheem, O., Penttilä, S., Lehtinen, S., Huovinen, S., Palmio, J., Tasca, G., Ricci, E., Hackman, P., Hauser, M., Katsanis, N., and Udd, B. (2012) Mutations affecting the cytoplasmic functions of the co-chaperone DNAJB6 cause limb-girdle muscular dystrophy. Nature Genetics. 44(4):450-455
1 - 2 of 2
Show