Morpholino

MO3-bbs9

ID
ZDB-MRPHLNO-140721-3
Name
MO3-bbs9
Previous Names
None
Target
Sequence
5' - AACTGCCCACTATAATCTTATCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This MO was based on the zv6 and currently the last three nucleotides do not match the current build (zv9).
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-bbs9
No data available
Phenotype
Phenotype resulting from MO3-bbs9
Phenotype Fish Figures
convergent extension process quality, abnormal WT + MO3-bbs9 Fig. 5 from Lindstrand et al., 2014
eye decreased size, abnormal WT + MO3-bbs9 Fig. 2 from Putoux et al., 2011
gastrulation disrupted, abnormal WT + MO3-bbs9 Fig. S4 with image from Zaghloul et al., 2010
head decreased size, abnormal WT + MO3-bbs9 Fig. 2 from Putoux et al., 2011
notochord increased width, abnormal WT + MO3-bbs9 Fig. 5 from Lindstrand et al., 2014
notochord kinked, abnormal WT + MO3-bbs9 Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
pronephric proximal convoluted tubule morphology, abnormal WT + MO3-bbs9 Fig. 5 from Lindstrand et al., 2014
pronephros development disrupted, abnormal WT + MO3-bbs9 Fig. 5 from Lindstrand et al., 2014
somite increased width, abnormal WT + MO3-bbs9 Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
somite shape, abnormal WT + MO3-bbs9 Fig. 2 from Putoux et al., 2011
whole organism anterior-posterior axis decreased length, abnormal WT + MO3-bbs9 Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
Phenotype of all Fish created by or utilizing MO3-bbs9
Phenotype Fish Conditions Figures
pronephros development disrupted, abnormal WT + MO3-bbs9 standard conditions Fig. 5 from Lindstrand et al., 2014
notochord increased width, abnormal WT + MO3-bbs9 standard conditions Fig. 5 from Lindstrand et al., 2014
head decreased size, abnormal WT + MO3-bbs9 standard conditions Fig. 2 from Putoux et al., 2011
notochord kinked, abnormal WT + MO3-bbs9 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
convergent extension process quality, abnormal WT + MO3-bbs9 standard conditions Fig. 5 from Lindstrand et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO3-bbs9 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
somite increased width, abnormal WT + MO3-bbs9 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
eye decreased size, abnormal WT + MO3-bbs9 standard conditions Fig. 2 from Putoux et al., 2011
pronephric proximal convoluted tubule morphology, abnormal WT + MO3-bbs9 standard conditions Fig. 5 from Lindstrand et al., 2014
somite shape, abnormal WT + MO3-bbs9 standard conditions Fig. 2 from Putoux et al., 2011
gastrulation disrupted, abnormal WT + MO3-bbs9 standard conditions Fig. S4 with image from Zaghloul et al., 2010
eye decreased size, abnormal WT + MO1-kif7 + MO3-bbs9 standard conditions Fig. 2 from Putoux et al., 2011
somite shape, abnormal WT + MO1-kif7 + MO3-bbs9 standard conditions Fig. 2 from Putoux et al., 2011
notochord kinked, abnormal WT + MO1-kif7 + MO3-bbs9 standard conditions Fig. 2 from Putoux et al., 2011
head decreased size, abnormal WT + MO1-kif7 + MO3-bbs9 standard conditions Fig. 2 from Putoux et al., 2011
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-kif7 + MO3-bbs9 standard conditions Fig. 2 from Putoux et al., 2011
somite increased width, abnormal WT + MO1-kif7 + MO3-bbs9 standard conditions Fig. 2 from Putoux et al., 2011
pronephros development disrupted, abnormal WT + MO2-nphp1 + MO3-bbs9 standard conditions Fig. 5 from Lindstrand et al., 2014
convergent extension process quality, abnormal WT + MO2-nphp1 + MO3-bbs9 standard conditions Fig. 5 from Lindstrand et al., 2014
pronephric proximal convoluted tubule morphology, abnormal WT + MO2-nphp1 + MO3-bbs9 standard conditions Fig. 5 from Lindstrand et al., 2014
notochord increased width, abnormal WT + MO2-nphp1 + MO3-bbs9 standard conditions Fig. 5 from Lindstrand et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-nphp1 + MO3-bbs9 standard conditions Fig. 5 from Lindstrand et al., 2014
somite increased width, abnormal WT + MO2-nphp1 + MO3-bbs9 standard conditions Fig. 5 from Lindstrand et al., 2014
notochord kinked, abnormal WT + MO2-nphp1 + MO3-bbs9 standard conditions Fig. 5 from Lindstrand et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.