Morpholino
MO1-flt3
- ID
- ZDB-MRPHLNO-140603-1
- Name
- MO1-flt3
- Previous Names
-
- flt3MO (1)
- Target
- Sequence
-
5' - GCGTGAATACATAACAGTTTGTTCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-flt3
No data available
Phenotype
Phenotype resulting from MO1-flt3
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-flt3
1 - 5 of 6 Show all
Citations
- Peng, X., Dong, M., Ma, L., Jia, X.E., Mao, J., Jin, C., Chen, Y., Gao, L., Liu, X., Ma, K., Wang, L., Du, T., Jin, Y., Huang, Q., Li, K., Zon, L.I., Liu, T., Deng, M., Zhou, Y., Xi, X., Zhou, Y., Chen, S. (2015) A point mutation of zebrafish c-cbl gene in the ring finger domain produces a phenotype mimicking human myeloproliferative disease. Leukemia. 29(12):2355-65
- He, B.L., Shi, X., Man, C.H., Ma, A.C., Ekker, S.C., Chow, H.C., So, C.W., Choi, W.W., Zhang, W., Zhang, Y., and Leung, A.Y. (2014) Functions of FMS-like tyrosine kinase 3 (flt3) in zebrafish hematopoiesis and its relevance to human acute myeloid leukemia. Blood. 123(16):2518-29
1 - 2 of 2
Show