Morpholino

MO2-hs3st1l1

ID

ZDB-MRPHLNO-140428-1

Name

MO2-hs3st1l1

Previous Names

Splice-blocking 3-OST-7 MO2 (1)

Target

hs3st1l1 (1)

Sequence

5' - CACATCTGGAAGACACAAGAGAGAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-hs3st1l1

Expressed Gene	Anatomy	Figures
bmp4	atrioventricular canal cardiac ventricle	Fig. 4 from Samson et al., 2013
notch1b	atrioventricular canal	Fig. 4 from Samson et al., 2013
tbx2b	atrioventricular canal	Fig. 4 from Samson et al., 2013
tpm4a	heart	Fig. 3 from Samson et al., 2013

Phenotype

Phenotype resulting from MO2-hs3st1l1

Phenotype	Fish	Figures
blood accumulation pericardium, abnormal	WT + MO2-hs3st1l1	Fig. 1 from Samson et al., 2013
blood circulation decreased process quality, abnormal	twu34Tg + MO2-hs3st1l1	Fig. 1 from Samson et al., 2013
cardiac ventricle hypoplastic, abnormal	twu34Tg + MO2-hs3st1l1	Fig. 1 from Samson et al., 2013
cardiac ventricle cardiac muscle cell decreased volume, abnormal	twu34Tg + MO2-hs3st1l1	Fig. 1 from Samson et al., 2013
cardiac ventricle heart contraction decreased process quality, abnormal	twu34Tg + MO2-hs3st1l1	Fig. 1 , Fig. 6 from Samson et al., 2013
cardiac ventricle heart contraction process quality, abnormal	twu34Tg + MO2-hs3st1l1	Fig. 1 from Samson et al., 2013
cardiac ventricle sarcomere disorganized, abnormal	WT + MO2-hs3st1l1	Fig. S2 from Samson et al., 2013
heart cardiac myofibril disorganized, abnormal	WT + MO2-hs3st1l1	Fig. 3 from Samson et al., 2013
heart muscle thin filament tropomyosin disorganized, abnormal	WT + MO2-hs3st1l1	Fig. 3 from Samson et al., 2013
heart sarcomere disorganized, abnormal	WT + MO2-hs3st1l1	Fig. 3 from Samson et al., 2013
heart troponin complex disorganized, abnormal	WT + MO2-hs3st1l1	Fig. 3 from Samson et al., 2013
pericardium edematous, abnormal	WT + MO2-hs3st1l1	Fig. 1 from Samson et al., 2013

Phenotype of all Fish created by or utilizing MO2-hs3st1l1

Phenotype	Fish	Conditions	Figures
heart sarcomere disorganized, abnormal	WT + MO2-hs3st1l1	standard conditions	Fig. 3 from Samson et al., 2013
cardiac ventricle sarcomere disorganized, abnormal	WT + MO2-hs3st1l1	standard conditions	Fig. S2 from Samson et al., 2013
heart troponin complex disorganized, abnormal	WT + MO2-hs3st1l1	standard conditions	Fig. 3 from Samson et al., 2013
cardiac ventricle heart contraction decreased process quality, abnormal	WT + MO2-hs3st1l1	standard conditions	Fig. 6 from Samson et al., 2013
heart cardiac myofibril disorganized, abnormal	WT + MO2-hs3st1l1	standard conditions	Fig. 3 from Samson et al., 2013
heart muscle thin filament tropomyosin disorganized, abnormal	WT + MO2-hs3st1l1	standard conditions	Fig. 3 from Samson et al., 2013
blood accumulation pericardium, abnormal	WT + MO2-hs3st1l1	standard conditions	Fig. 1 from Samson et al., 2013
pericardium edematous, abnormal	WT + MO2-hs3st1l1	standard conditions	Fig. 1 from Samson et al., 2013
blood circulation decreased process quality, abnormal	twu34Tg + MO2-hs3st1l1	standard conditions	Fig. 1 from Samson et al., 2013
cardiac ventricle hypoplastic, abnormal	twu34Tg + MO2-hs3st1l1	standard conditions	Fig. 1 from Samson et al., 2013
cardiac ventricle heart contraction decreased process quality, abnormal	twu34Tg + MO2-hs3st1l1	standard conditions	Fig. 1 from Samson et al., 2013
cardiac ventricle cardiac muscle cell decreased volume, abnormal	twu34Tg + MO2-hs3st1l1	standard conditions	Fig. 1 from Samson et al., 2013
cardiac ventricle heart contraction process quality, abnormal	twu34Tg + MO2-hs3st1l1	standard conditions	Fig. 1 from Samson et al., 2013

Citations