Morpholino
MO7-aplnra
- ID
- ZDB-MRPHLNO-140421-6
- Name
- MO7-aplnra
- Previous Names
- None
- Target
- Sequence
-
5' - CGGTGTATTCCGGCGTTGGCTCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO7-aplnra
No data available
Phenotype
Phenotype resulting from MO7-aplnra
No data available
Phenotype of all Fish created by or utilizing MO7-aplnra
1 - 5 of 15 Show all
Citations
- Stock, J., Kazmar, T., Schlumm, F., Hannezo, E., Pauli, A. (2022) A self-generated Toddler gradient guides mesodermal cell migration. Science advances. 8:eadd2488
- Liu, Z., Woo, S., Weiner, O.D. (2018) Nodal signaling has dual roles in fate specification and directed migration during germ layer segregation. Development (Cambridge, England). 145(17):
- Deshwar, A.R., Chng, S.C., Ho, L., Reversade, B., Scott, I.C. (2016) The Apelin receptor enhances Nodal/TGFβ signaling to ensure proper cardiac development. eLIFE. 5
- Pauli, A., Norris, M.L., Valen, E., Chew, G.L., Gagnon, J.A., Zimmerman, S., Mitchell, A., Ma, J., Dubrulle, J., Reyon, D., Tsai, S.Q., Joung, J.K., Saghatelian, A., and Schier, A.F. (2014) Toddler: an embryonic signal that promotes cell movement via Apelin receptors. Science (New York, N.Y.). 343(6172):1248636
1 - 4 of 4
Show