Morpholino
MO2-klhl41b
- ID
- ZDB-MRPHLNO-140213-7
- Name
- MO2-klhl41b
- Previous Names
- None
- Target
- Sequence
-
5' - TCAAAGATGAACTCATACTCGGTGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-klhl41b
No data available
Phenotype
Phenotype resulting from MO2-klhl41b
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO2-klhl41b
1 - 5 of 28 Show all
Citations
- Jirka, C., Pak, J.H., Grosgogeat, C.A., Marchetii, M.M., Gupta, V.A. (2019) Dysregulation of NRAP degradation by KLHL41 contributes to pathophysiology in Nemaline Myopathy. Human molecular genetics. 28(15):2549-2560
- Gupta, V.A., Ravenscroft, G., Shaheen, R., Todd, E.J., Swanson, L.C., Shiina, M., Ogata, K., Hsu, C., Clarke, N.F., Darras, B.T., Farrar, M.A., Hashem, A., Manton, N.D., Muntoni, F., North, K.N., Sandaradura, S.A., Nishino, I., Hayashi, Y.K., Sewry, C.A., Thompson, E.M., Yau, K.S., Brownstein, C.A., Yu, T.W., Allcock, R.J., Davis, M.R., Wallgren-Pettersson, C., Matsumoto, N., Alkuraya, F.S., Laing, N.G., and Beggs, A.H. (2013) Identification of KLHL41 Mutations Implicates BTB-Kelch-Mediated Ubiquitination as an Alternate Pathway to Myofibrillar Disruption in Nemaline Myopathy. American journal of human genetics. 93(6):1108-1117
1 - 2 of 2
Show