Morpholino
MO2-thrb
- ID
- ZDB-MRPHLNO-131114-1
- Name
- MO2-thrb
- Previous Names
-
- Splice-blocking MO. (1)
- Target
- Sequence
-
5' - TCTAGAACTTGCAATACCTTTCTTA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-thrb
No data available
Phenotype
Phenotype resulting from MO2-thrb
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO2-thrb
1 - 5 of 14 Show all
Citations
- DuVal, M.G., Allison, W.T. (2018) Photoreceptor Progenitors Depend Upon Coordination of gdf6a, thrβ, and tbx2b to Generate Precise Populations of Cone Photoreceptor Subtypes. Investigative ophthalmology & visual science. 59:6089-6101
- Yoshimatsu, T., Williams, P.R., D'Orazi, F.D., Suzuki, S.C., Fadool, J.M., Allison, W.T., Raymond, P.A., Wong, R.O. (2014) Transmission from the dominant input shapes the stereotypic ratio of photoreceptor inputs onto horizontal cells. Nature communications. 5:3699
- Suzuki, S.C., Bleckert, A., Williams, P.R., Takechi, M., Kawamura, S., and Wong, R.O. (2013) Cone photoreceptor types in zebrafish are generated by symmetric terminal divisions of dedicated precursors. Proceedings of the National Academy of Sciences of the United States of America. 110(37):15109-14
1 - 3 of 3
Show