Morpholino

MO1-mir148

ID
ZDB-MRPHLNO-131028-1
Name
MO1-mir148
Previous Names
None
Target
Sequence
5' - ACAAAGTTCTGTAATGCACTGACTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir148
Phenotype
Phenotype resulting from MO1-mir148
Phenotype of all Fish created by or utilizing MO1-mir148
Citations