Morpholino
MO2-tnfrsf1b
- ID
- ZDB-MRPHLNO-130620-1
- Name
- MO2-tnfrsf1b
- Previous Names
-
- tnfr2 MO (1)
- Target
- Sequence
-
5' - GGAATCTGTGAACACAAAGGGACAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tnfrsf1b
No data available
Phenotype
Phenotype resulting from MO2-tnfrsf1b
1 - 5 of 24 Show all
Phenotype of all Fish created by or utilizing MO2-tnfrsf1b
1 - 5 of 43 Show all
Citations
- Martínez-Navarro, F.J., Martínez-Morcillo, F.J., López-Muñoz, A., Pardo-Sánchez, I., Martínez-Menchón, T., Corbalán-Vélez, R., Cayuela, M.L., Pérez-Oliva, A.B., García-Moreno, D., Mulero, V. (2020) The vitamin B6-dependent enzymes PYGL and G6PD fuel NADPH oxidases to promote skin inflammation. Developmental and comparative immunology. 108:103666
- Smith, C.J., Wheeler, M.A., Marjoram, L., Bagnat, M., Deppmann, C.D., Kucenas, S. (2017) TNFa/TNFR2 signaling is required for glial ensheathment at the dorsal root entry zone. PLoS Genetics. 13:e1006712
- Espín-Palazón, R., Martínez-López, A., Roca, F.J., López-Muñoz, A., Tyrkalska, S.D., Candel, S., García-Moreno, D., Falco, A., Meseguer, J., Estepa, A., Mulero, V. (2016) TNFα Impairs Rhabdoviral Clearance by Inhibiting the Host Autophagic Antiviral Response. PLoS pathogens. 12:e1005699
- Candel, S., de Oliveira, S., López-Muñoz, A., García-Moreno, D., Espín-Palazón, R., Tyrkalska, S.D., Cayuela, M.L., Renshaw, S.A., Corbalán-Vélez, R., Vidal-Abarca, I., Tsai, H.J., Meseguer, J., Sepulcre, M.P., Mulero, V. (2014) Tnfa signaling through tnfr2 protects skin against oxidative stress-induced inflammation. PLoS Biology. 12:e1001855
- Espín-Palazón, R., Stachura, D.L., Campbell, C.A., García-Moreno, D., Del Cid, N., Kim, A.D., Candel, S., Meseguer, J., Mulero, V., Traver, D. (2014) Proinflammatory signaling regulates hematopoietic stem cell emergence. Cell. 159:1070-85
- Espín, R., Roca, F.J., Candel, S., Sepulcre, M.P., González-Rosa, J.M., Alcaraz-Pérez, F., Meseguer, J., Cayuela, M.L., Mercader, N., and Mulero, V. (2013) TNF receptors regulate vascular homeostasis through a caspase-8, caspase-2 and P53 apoptotic program that bypasses caspase-3. Disease models & mechanisms. 6(2):383-396
1 - 6 of 6
Show