Morpholino

MO3-mmp2

ID

ZDB-MRPHLNO-130607-2

Name

MO3-mmp2

Previous Names

None

Target

mmp2 (1)

Sequence

5' - GGGAGCTTAGTAAACACAAACCTGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-mmp2

Expressed Gene	Anatomy	Figures
dbh	chromaffin cell	Fig. 7 from Chou et al., 2014
nr5a1a	interrenal gland interrenal primordium	Fig. 7 from Chou et al., 2014

Phenotype

Phenotype resulting from MO3-mmp2

Phenotype	Fish	Figures
adrenal gland development process quality, abnormal	WT + MO3-mmp2	Fig. 5 , Fig. 7 from Chou et al., 2014
interrenal angiogenic sprout decreased length, abnormal	s843Tg + MO3-mmp2	Fig. 5 from Chou et al., 2014
interrenal gland position, abnormal	s843Tg + MO3-mmp2	Fig. 5 from Chou et al., 2014
interrenal gland animal organ morphogenesis process quality, abnormal	WT + MO3-mmp2	Fig. 5 , Fig. 7 from Chou et al., 2014
interrenal gland epithelial to mesenchymal transition decreased occurrence, abnormal	zf346Tg + MO3-mmp2	Fig. 6 from Chou et al., 2014
lymph vessel development disrupted, abnormal	hu4453Tg + MO3-mmp2	Fig. 2 from Detry et al., 2012
thoracic duct hypoplastic, abnormal	y1Tg + MO3-mmp2	Fig. 2 from Detry et al., 2012
whole organism edematous, abnormal	hu4453Tg + MO3-mmp2	text only from Detry et al., 2012
whole organism viability, abnormal	hu4453Tg + MO3-mmp2	text only from Detry et al., 2012

Phenotype of all Fish created by or utilizing MO3-mmp2

Phenotype	Fish	Conditions	Figures
interrenal gland animal organ morphogenesis process quality, abnormal	WT + MO3-mmp2	standard conditions	Fig. 7 from Chou et al., 2014
adrenal gland development process quality, abnormal	WT + MO3-mmp2	standard conditions	Fig. 7 from Chou et al., 2014
whole organism edematous, abnormal	hu4453Tg + MO3-mmp2	standard conditions	text only from Detry et al., 2012
thoracic duct hypoplastic, abnormal	hu4453Tg + MO3-mmp2	standard conditions	Fig. 2 from Detry et al., 2012
lymph vessel development disrupted, abnormal	hu4453Tg + MO3-mmp2	standard conditions	Fig. 2 from Detry et al., 2012
whole organism viability, abnormal	hu4453Tg + MO3-mmp2	standard conditions	text only from Detry et al., 2012
interrenal gland position, abnormal	s843Tg + MO3-mmp2	standard conditions	Fig. 5 from Chou et al., 2014
interrenal gland animal organ morphogenesis process quality, abnormal	s843Tg + MO3-mmp2	standard conditions	Fig. 5 from Chou et al., 2014
adrenal gland development process quality, abnormal	s843Tg + MO3-mmp2	standard conditions	Fig. 5 from Chou et al., 2014
interrenal angiogenic sprout decreased length, abnormal	s843Tg + MO3-mmp2	standard conditions	Fig. 5 from Chou et al., 2014
whole organism edematous, abnormal	y1Tg + MO3-mmp2	standard conditions	text only from Detry et al., 2012
whole organism viability, abnormal	y1Tg + MO3-mmp2	standard conditions	text only from Detry et al., 2012
lymph vessel development disrupted, abnormal	y1Tg + MO3-mmp2	standard conditions	Fig. 2 from Detry et al., 2012
thoracic duct hypoplastic, abnormal	y1Tg + MO3-mmp2	standard conditions	Fig. 2 from Detry et al., 2012
interrenal gland epithelial to mesenchymal transition decreased occurrence, abnormal	zf346Tg + MO3-mmp2	standard conditions	Fig. 6 from Chou et al., 2014

Citations