Morpholino
MO3-agrp
- ID
- ZDB-MRPHLNO-130226-3
- Name
- MO3-agrp
- Previous Names
- 
    
        
    
    
        
        - agrp I1E2 MO (1)
 
- Target
- Sequence
- 
    
        
        
    
        
            
                5' - GCAGTGAGTCTATGATGTACAAAAC - 3'
                
            
            
                
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- 
    
        
        
    
        
            Splice-blocking MO.
- Genome Resources
- None
                
                    
                        Target Location
                    
                    
                
                
            
        
        
    
        
            
            
    
        
    
    
    
        
        
    
    
    
                
                    
                        Genomic Features
                    
                    
                
                
            
        
        
    
        
            
            
    
    
        
    
No data available
    
        
        
    
    
    
                
                    
                        Expression
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Gene expression in Wild Types + MO3-agrp
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Phenotype
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Phenotype resulting from MO3-agrp
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    
    
    
            
        
    
    
    
                
                    
                        Phenotype of all Fish created by or utilizing MO3-agrp
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    | Phenotype | Fish | Conditions | Figures | 
|---|---|---|---|
| developmental growth process quality, abnormal | WT + MO3-agrp | standard conditions | Fig. S1  from Zhang et al., 2012 | 
| whole organism decreased length, abnormal | WT + MO3-agrp | standard conditions | Fig. S1  from Zhang et al., 2012 | 
                
                    
                        Citations
                    
                    
                
                
            
        
        
    
        
            
            
        
        
    
    
    