Morpholino
MO1-popdc1
- ID
- ZDB-MRPHLNO-130104-1
- Name
- MO1-popdc1
- Previous Names
-
- MO1-bves
- Target
- Sequence
-
5' - GATGTTGTGTTGGACATTCTGAGGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-popdc1
No data available
Phenotype
Phenotype resulting from MO1-popdc1
1 - 5 of 44 Show all
Phenotype of all Fish created by or utilizing MO1-popdc1
1 - 5 of 48 Show all
Citations
- Shi, Y., Li, Y., Wang, Y., Zhu, P., Chen, Y., Wang, H., Yue, S., Xia, X., Chen, J., Jiang, Z., Zhou, C., Cai, W., Yuan, H., Wu, Y., Wan, Y., Li, X., Zhu, X., Zhou, Z., Dai, G., Li, F., Mo, X., Ye, X., Fan, X., Zhuang, J., Wu, X., Yuan, W. (2020) BVES downregulation in non-syndromic tetralogy of fallot is associated with ventricular outflow tract stenosis. Scientific Reports. 10:14167
- Wu, Y.C., Chen, R.F., Liu, C.Y., Hu, F.R., Huang, C.J., Wang, I.J. (2014) Knockdown of zebrafish blood vessel epicardial substance results in incomplete retinal lamination. TheScientificWorldJournal. 2014:803718
- Wu, Y.C., Liu, C.Y., Chen, Y.H., Chen, R.F., Sun, T.T., Huang, C.J., and Wang, I.J. (2012) Blood vessel epicardial substance (BVES) regulates epidermal tight junction integrity through atypical protein kinase C. The Journal of biological chemistry. 287(47):39887-39897
1 - 3 of 3
Show