Morpholino

MO1-tlcd3ba

ID
ZDB-MRPHLNO-121207-6
Name
MO1-tlcd3ba
Previous Names
  • MO1-fam57ba
Target
Sequence
5' - ATGCCTGGAAGGAAAATGGAAGAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tlcd3ba
No data available
Phenotype
Phenotype resulting from MO1-tlcd3ba
Phenotype of all Fish created by or utilizing MO1-tlcd3ba
Phenotype Fish Conditions Figures
forebrain axon decreased size, abnormal WT + MO1-tlcd3ba standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal WT + MO1-tlcd3ba standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
midbrain shape, abnormal WT + MO1-tlcd3ba standard conditions Fig. 2 with image from Blaker-Lee et al., 2012
hindbrain axon decreased length, abnormal WT + MO1-tlcd3ba standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
whole organism movement quality, abnormal WT + MO1-tlcd3ba standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
somite U-shaped, abnormal WT + MO1-tlcd3ba standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
whole organism pigmented, abnormal WT + MO1-tlcd3ba standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
forebrain decreased width, abnormal WT + MO1-tlcd3ba standard conditions Fig. 2 with image from Blaker-Lee et al., 2012
pigment cell decreased amount, abnormal WT + MO1-tlcd3ba standard conditions Fig. S3 with image from Blaker-Lee et al., 2012
eye morphology, abnormal WT + MO1-tlcd3ba standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
forebrain axon disorganized, abnormal WT + MO1-tlcd3ba standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
brain morphology, abnormal WT + MO1-tlcd3ba standard conditions Fig. 2 with image from Blaker-Lee et al., 2012
hindbrain axon disorganized, abnormal WT + MO1-tlcd3ba standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal WT + MO1-tlcd3ba standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
ventricular system morphology, abnormal AB + MO1-aldoaa + MO1-tlcd3ba standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-aldoaa + MO1-tlcd3ba standard conditions Table S2 from McCammon et al., 2017
whole organism doc2a expression decreased amount, abnormal AB + MO1-doc2a + MO1-tlcd3ba standard conditions Fig. S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-doc2a + MO1-tlcd3ba standard conditions Fig. S1 with image,  Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-doc2a + MO1-tlcd3ba standard conditions Fig. S1 with image,  Table S2 from McCammon et al., 2017
whole organism tlcd3ba expression decreased amount, abnormal AB + MO1-doc2a + MO1-tlcd3ba standard conditions Fig. S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-tlcd3ba + MO2-kctd13 standard conditions Fig. S1 with image,  Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-tlcd3ba + MO2-kctd13 standard conditions Fig. S1 with image,  Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal nl1Tg + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
cranial nerve development process quality, abnormal rw0Tg + MO1-aldoaa + MO1-tlcd3ba standard conditions Table S2 from McCammon et al., 2017
cranial nerve development process quality, abnormal rw0Tg + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Fig. S3 with image,  Table S2 from McCammon et al., 2017
cranial nerve V decreased size, abnormal rw0Tg + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Fig. S3 with image from McCammon et al., 2017
cranial nerve VII shape, abnormal rw0Tg + MO1-hirip3 + MO1-tlcd3ba + MO4-tp53 standard conditions Fig. S3 with image from McCammon et al., 2017
Citations