Morpholino

MO1-coro1a

ID
ZDB-MRPHLNO-121207-4
Name
MO1-coro1a
Previous Names
None
Target
Sequence
5' - TGGTTTCTGATGTGGTTTACCTGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-coro1a
No data available
Phenotype
Phenotype resulting from MO1-coro1a
Phenotype Fish Figures
brain morphology, abnormal WT + MO1-coro1a Fig. 2 with image from Blaker-Lee et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal WT + MO1-coro1a Fig. 3 with image from Blaker-Lee et al., 2012
eye morphology, abnormal WT + MO1-coro1a Fig. 3 with image from Blaker-Lee et al., 2012
forebrain axon decreased size, abnormal WT + MO1-coro1a Fig. 5 with image from Blaker-Lee et al., 2012
forebrain axon disorganized, abnormal WT + MO1-coro1a Fig. 5 with image from Blaker-Lee et al., 2012
hindbrain axon decreased length, abnormal WT + MO1-coro1a Fig. 5 with image from Blaker-Lee et al., 2012
hindbrain axon disorganized, abnormal WT + MO1-coro1a Fig. 5 with image from Blaker-Lee et al., 2012
pigment cell decreased amount, abnormal WT + MO1-coro1a Fig. S3 with image from Blaker-Lee et al., 2012
post-vent region decreased length, abnormal WT + MO1-coro1a Fig. 3 with image from Blaker-Lee et al., 2012
post-vent region shape, abnormal WT + MO1-coro1a Fig. 3 with image from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal WT + MO1-coro1a Fig. 3 with image from Blaker-Lee et al., 2012
whole organism movement quality, abnormal WT + MO1-coro1a Fig. 3 with image from Blaker-Lee et al., 2012
whole organism pigmented, abnormal WT + MO1-coro1a Fig. 3 with image from Blaker-Lee et al., 2012
Phenotype of all Fish created by or utilizing MO1-coro1a
Phenotype Fish Conditions Figures
post-vent region shape, abnormal WT + MO1-coro1a standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
pigment cell decreased amount, abnormal WT + MO1-coro1a standard conditions Fig. S3 with image from Blaker-Lee et al., 2012
eye morphology, abnormal WT + MO1-coro1a standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
brain morphology, abnormal WT + MO1-coro1a standard conditions Fig. 2 with image from Blaker-Lee et al., 2012
whole organism pigmented, abnormal WT + MO1-coro1a standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
post-vent region decreased length, abnormal WT + MO1-coro1a standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
whole organism movement quality, abnormal WT + MO1-coro1a standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal WT + MO1-coro1a standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal WT + MO1-coro1a standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
forebrain axon decreased size, abnormal WT + MO1-coro1a standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
forebrain axon disorganized, abnormal WT + MO1-coro1a standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
hindbrain axon decreased length, abnormal WT + MO1-coro1a standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
hindbrain axon disorganized, abnormal WT + MO1-coro1a standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.