Morpholino

MO2-kctd13

ID

ZDB-MRPHLNO-121207-12

Name

MO2-kctd13

Previous Names

None

Target

kctd13 (1)

Sequence

5' - CCAGCCTTCAATACAAATGGACACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-kctd13

No data available

Phenotype

Phenotype resulting from MO2-kctd13

Phenotype	Fish	Figures
brain morphology, abnormal	WT + MO2-kctd13	Fig. 2 from Blaker-Lee et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal	WT + MO2-kctd13	Fig. 3 from Blaker-Lee et al., 2012
forebrain axon decreased size, abnormal	WT + MO2-kctd13	Fig. 5 from Blaker-Lee et al., 2012
forebrain axon disorganized, abnormal	WT + MO2-kctd13	Fig. 5 from Blaker-Lee et al., 2012
hindbrain axon decreased length, abnormal	WT + MO2-kctd13	Fig. 5 from Blaker-Lee et al., 2012
hindbrain axon disorganized, abnormal	WT + MO2-kctd13	Fig. 5 from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal	WT + MO2-kctd13	Fig. 3 from Blaker-Lee et al., 2012
ventricular system decreased size, abnormal	WT + MO2-kctd13	Fig. 2 from Blaker-Lee et al., 2012

Phenotype of all Fish created by or utilizing MO2-kctd13

Phenotype	Fish	Conditions	Figures
brain morphology, abnormal	WT + MO2-kctd13	standard conditions	Fig. 2 from Blaker-Lee et al., 2012
forebrain axon decreased size, abnormal	WT + MO2-kctd13	standard conditions	Fig. 5 from Blaker-Lee et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal	WT + MO2-kctd13	standard conditions	Fig. 3 from Blaker-Lee et al., 2012
hindbrain axon decreased length, abnormal	WT + MO2-kctd13	standard conditions	Fig. 5 from Blaker-Lee et al., 2012
ventricular system decreased size, abnormal	WT + MO2-kctd13	standard conditions	Fig. 2 from Blaker-Lee et al., 2012
forebrain axon disorganized, abnormal	WT + MO2-kctd13	standard conditions	Fig. 5 from Blaker-Lee et al., 2012
hindbrain axon disorganized, abnormal	WT + MO2-kctd13	standard conditions	Fig. 5 from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal	WT + MO2-kctd13	standard conditions	Fig. 3 from Blaker-Lee et al., 2012
ventricular system morphology, abnormal	AB + MO1-tlcd3ba + MO2-kctd13	standard conditions	Fig. S1 , Table S2 from McCammon et al., 2017
brain morphology, abnormal	AB + MO1-tlcd3ba + MO2-kctd13	standard conditions	Fig. S1 , Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal	AB + MO2-kctd13 + MO3-cdipt	standard conditions	Fig. S1 , Table S2 from McCammon et al., 2017
brain morphology, abnormal	AB + MO2-kctd13 + MO3-cdipt	standard conditions	Fig. S1 , Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal	AB + MO2-kctd13 + MO4-tp53 + MO5-ppp4ca	standard conditions	Table S2 from McCammon et al., 2017
enteric neuron decreased amount, abnormal	AB + MO2-kctd13 + MO4-tp53 + MO5-ppp4ca	standard conditions	Table S2 from McCammon et al., 2017
brain morphology, abnormal	AB + MO2-kctd13 + MO4-tp53 + MO5-ppp4ca	standard conditions	Table S2 from McCammon et al., 2017
optic tectum EGFP expression decreased amount, abnormal	nl1Tg + MO2-kctd13 + MO3-cdipt	standard conditions	Fig. S3 from McCammon et al., 2017
retinal ganglion cell EGFP expression decreased amount, abnormal	nl1Tg + MO2-kctd13 + MO3-cdipt	standard conditions	Fig. S3 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal	nl1Tg + MO2-kctd13 + MO3-cdipt	standard conditions	Fig. S3 , Table S2 from McCammon et al., 2017
cranial nerve development process quality, abnormal	rw0Tg + MO2-kctd13 + MO4-tp53 + MO5-ppp4ca	standard conditions	Table S2 from McCammon et al., 2017

Citations