Morpholino

MO2-lpar3

ID
ZDB-MRPHLNO-121114-4
Name
MO2-lpar3
Previous Names
  • tMO1 (1)
Target
Sequence
5' - TTGGACAAAACCCACTAGGACAGTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-lpar3
Phenotype
Phenotype resulting from MO2-lpar3
Phenotype Fish Figures
blood accumulation yolk, abnormal AB + MO2-lpar3 Fig. S3 with image from Lai et al., 2012
brain hemorrhagic, abnormal AB + MO2-lpar3 Fig. S3 with image from Lai et al., 2012
calcium-mediated signaling disrupted, abnormal AB + MO2-lpar3 Fig. 6 with image from Lai et al., 2012
cilium assembly disrupted, abnormal AB + MO2-lpar3 Fig. 5 with image from Lai et al., 2012
determination of heart left/right asymmetry disrupted, abnormal AB + MO2-lpar3 Fig. 2 with imageFig. 7 with image from Lai et al., 2012
determination of left/right asymmetry in diencephalon disrupted, abnormal AB + MO2-lpar3 Fig. 2 with image from Lai et al., 2012
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal AB + MO2-lpar3 Fig. 2 with image from Lai et al., 2012
determination of left/right symmetry disrupted, abnormal AB + MO2-lpar3 Fig. 2 with image from Lai et al., 2012
erythrocyte differentiation disrupted, abnormal WT + MO2-lpar3 Fig. 1Fig. S2 from Chiang et al., 2011
eye hemorrhagic, abnormal AB + MO2-lpar3 Fig. S3 with image from Lai et al., 2012
forerunner cell group distributed, abnormal s870Tg + MO2-lpar3 Fig. 4 with image from Lai et al., 2012
heart bifurcated, abnormal AB + MO2-lpar3 Fig. 7 with image from Lai et al., 2012
heart jogging disrupted, abnormal AB + MO2-lpar3 Fig. 1 with imageFig. 7 with image from Lai et al., 2012
heart looping disrupted, abnormal AB + MO2-lpar3 Fig. 1 with imageFig. 7 with image from Lai et al., 2012
hemoglobin biosynthetic process decreased occurrence, abnormal WT + MO2-lpar3 Fig. 5 with image from Lin et al., 2016
Kupffer's vesicle decreased size, abnormal s903Tg + MO2-lpar3 Fig. 3 with image from Lai et al., 2012
Kupffer's vesicle deformed, abnormal s903Tg + MO2-lpar3 Fig. 3 with image from Lai et al., 2012
Kupffer's vesicle morphology, abnormal AB + MO2-lpar3 Fig. 5 with image from Lai et al., 2012
Kupffer's vesicle cell mislocalised, abnormal s903Tg + MO2-lpar3 Fig. 3 with image from Lai et al., 2012
Kupffer's vesicle cilium decreased amount, abnormal AB + MO2-lpar3 Fig. 5 with image from Lai et al., 2012
Kupffer's vesicle cilium decreased volume, abnormal AB + MO2-lpar3 Fig. 5 with image from Lai et al., 2012
nucleate erythrocyte absent, abnormal WT + MO2-lpar3 Fig. 1 from Chiang et al., 2011
nucleate erythrocyte decreased amount, abnormal AB + MO2-lpar3 Fig. S3 with image from Lai et al., 2012
nucleate erythrocyte mislocalised, abnormal AB + MO2-lpar3 Fig. S3 with image from Lai et al., 2012
pericardium edematous, abnormal AB + MO2-lpar3 Fig. S3 with image from Lai et al., 2012
Phenotype of all Fish created by or utilizing MO2-lpar3
Phenotype Fish Conditions Figures
Kupffer's vesicle cilium decreased amount, abnormal AB + MO2-lpar3 standard conditions Fig. 5 with image from Lai et al., 2012
nucleate erythrocyte mislocalised, abnormal AB + MO2-lpar3 standard conditions Fig. S3 with image from Lai et al., 2012
heart jogging disrupted, abnormal AB + MO2-lpar3 standard conditions Fig. 1 with imageFig. 7 with image from Lai et al., 2012
Kupffer's vesicle morphology, abnormal AB + MO2-lpar3 standard conditions Fig. 5 with image from Lai et al., 2012
nucleate erythrocyte decreased amount, abnormal AB + MO2-lpar3 standard conditions Fig. S3 with image from Lai et al., 2012
calcium-mediated signaling disrupted, abnormal AB + MO2-lpar3 standard conditions Fig. 6 with image from Lai et al., 2012
determination of left/right asymmetry in diencephalon disrupted, abnormal AB + MO2-lpar3 standard conditions Fig. 2 with image from Lai et al., 2012
determination of heart left/right asymmetry disrupted, abnormal AB + MO2-lpar3 standard conditions Fig. 2 with imageFig. 7 with image from Lai et al., 2012
determination of left/right symmetry disrupted, abnormal AB + MO2-lpar3 standard conditions Fig. 2 with image from Lai et al., 2012
heart looping disrupted, abnormal AB + MO2-lpar3 standard conditions Fig. 1 with imageFig. 7 with image from Lai et al., 2012
Kupffer's vesicle cilium decreased volume, abnormal AB + MO2-lpar3 standard conditions Fig. 5 with image from Lai et al., 2012
pericardium edematous, abnormal AB + MO2-lpar3 standard conditions Fig. S3 with image from Lai et al., 2012
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal AB + MO2-lpar3 standard conditions Fig. 2 with image from Lai et al., 2012
blood accumulation yolk, abnormal AB + MO2-lpar3 standard conditions Fig. S3 with image from Lai et al., 2012
heart bifurcated, abnormal AB + MO2-lpar3 standard conditions Fig. 7 with image from Lai et al., 2012
eye hemorrhagic, abnormal AB + MO2-lpar3 standard conditions Fig. S3 with image from Lai et al., 2012
brain hemorrhagic, abnormal AB + MO2-lpar3 standard conditions Fig. S3 with image from Lai et al., 2012
cilium assembly disrupted, abnormal AB + MO2-lpar3 standard conditions Fig. 5 with image from Lai et al., 2012
forerunner cell group distributed, abnormal AB + MO2-lpar3 standard conditions Fig. 4 with image from Lai et al., 2012
erythrocyte differentiation disrupted, abnormal WT + MO2-lpar3 standard conditions Fig. 1Fig. S2 from Chiang et al., 2011
hemoglobin biosynthetic process occurrence, ameliorated WT + MO2-lpar3 chemical treatment: (2S)-1-oleoyl-2-methylglycero-3-phosphothionate Fig. 5 with image from Lin et al., 2016
hemoglobin biosynthetic process decreased occurrence, abnormal WT + MO2-lpar3 standard conditions Fig. 5 with image from Lin et al., 2016
nucleate erythrocyte absent, abnormal WT + MO2-lpar3 standard conditions Fig. 1 from Chiang et al., 2011
forerunner cell group distributed, abnormal s870Tg + MO2-lpar3 standard conditions Fig. 4 with image from Lai et al., 2012
Kupffer's vesicle deformed, abnormal s870Tg + MO2-lpar3 standard conditions Fig. 3 with image from Lai et al., 2012
Kupffer's vesicle decreased size, abnormal s903Tg + MO2-lpar3 standard conditions Fig. 3 with image from Lai et al., 2012
Kupffer's vesicle cell mislocalised, abnormal s903Tg + MO2-lpar3 standard conditions Fig. 3 with image from Lai et al., 2012
Kupffer's vesicle deformed, abnormal s903Tg + MO2-lpar3 standard conditions Fig. 3 with image from Lai et al., 2012
blood accumulation yolk, abnormal AB + MO2-lpar3 + MO5-enpp2 standard conditions Fig. S3 with image from Lai et al., 2012
Citations