Morpholino
MO3-ctnnd1
- ID
- ZDB-MRPHLNO-121031-9
- Name
- MO3-ctnnd1
- Previous Names
- None
- Target
- Sequence
-
5' - CTAGCATGTACTCACAGTCCAGCGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ctnnd1
No data available
Phenotype
Phenotype resulting from MO3-ctnnd1
1 - 5 of 19 Show all
Phenotype of all Fish created by or utilizing MO3-ctnnd1
1 - 5 of 20 Show all
Citations
- Kupai, A., Nakahara, H., Voss, K.M., Hirano, M.S., Rodriguez, A., Lackey, D.L., Murayama, J.F., Mathieson, C.J., Shan, B., Horton, E.C., Curtis, G.H., Huang, J., Hille, M.B. (2022) Phosphorylation of serine residues S252, S268/S269, and S879 in p120 catenin activates migration of presomitic mesoderm in gastrulating zebrafish embryos. Developmental Dynamics : an official publication of the American Association of Anatomists. 251(12):1952-1967
- Shan, B., Horton, E.C., Xu, S.C., Huntington, K.E., Kawano, D.K., Mendoza, C.L., Lin, L., Stafford, C.M., Allen, E.D., Huang, J., Nakahara, H., Greenstein, L.E., Hille, M.B. (2022) Dephosphorylation of Y228 and Y217 and phosphorylation of Y335 in p120 catenin activate convergent extension during zebrafish gastrulation. Developmental Dynamics : an official publication of the American Association of Anatomists. 251(12):1934-1951
- Hsu, C.L., Muerdter, C.P., Knickerbocker, A.D., Walsh, R.M., Zepeda-Rivera, M.A., Depner, K.H., Sangesland, M., Cisneros, T.B., Kim, J.Y., Sanchez-Vazquez, P., Cherezova, L., Regan, R.D., Bahrami, N.M., Gray, E.A., Chan, A.Y., Chen, T., Rao, M.Y., and Hille, M.B. (2012) Cdc42 GTPase and Rac1 GTPase act downstream of p120 catenin and require GTP exchange during gastrulation of zebrafish mesoderm. Developmental Dynamics : an official publication of the American Association of Anatomists. 241(10):1545-1561
1 - 3 of 3
Show