Morpholino
MO2-th
- ID
- ZDB-MRPHLNO-120827-4
- Name
- MO2-th
- Previous Names
-
- targets exon3 (1)
- Target
- Sequence
-
5' - CAGGTTAACAGACTTACATTTGACC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-th
No data available
Phenotype
Phenotype resulting from MO2-th
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO2-th
1 - 4 of 4
Citations
- Damm, E.W., Clements, W.K. (2017) Pdgf signalling guides neural crest contribution to the haematopoietic stem cell specification niche. Nature cell biology. 19(5):457-467
- Kwan, W., Cortes, M., Frost, I., Esain, V., Theodore, L.N., Liu, S.Y., Budrow, N., Goessling, W., North, T.E. (2016) The Central Nervous System Regulates Embryonic HSPC Production via Stress-Responsive Glucocorticoid Receptor Signaling. Cell Stem Cell. 19:370-82
- O'Hare, E.A., Yerges-Armstrong, L.M., Perry, J.A., Shuldiner, A.R., Zaghloul, N.A. (2016) Assignment of Functional Relevance to Genes at Type 2 Diabetes-Associated Loci Through Investigation of β-Cell Mass Deficits. Molecular endocrinology (Baltimore, Md.). 30(4):429-45
- Formella, I., Scott, E.K., Burne, T.H., Harms, L.R., Liu, P.Y., Turner, K.M., Cui, X., and Eyles, D.W. (2012) Transient Knockdown of Tyrosine Hydroxylase during Development Has Persistent Effects on Behaviour in Adult Zebrafish (Danio rerio). PLoS One. 7(8):e42482
1 - 4 of 4
Show